This blog is a way of sharing the information and resources that have helped me to recover my son Roo from an Autism Spectrum Disorder. What I have learned is to view our symptoms as the results of underlying biological cause, which can be identified and healed. I say "our symptoms" because I also have a neuro-immune disorder called Myalgic Encephalomyelitis.

And, of course, I am not a doctor (although I have been known to impersonate one while doing imaginative play with my son)- this is just our story and information that has been helpful or interesting to us. I hope it is helpful and interesting to you!


Tuesday, May 17, 2016

Mast Cell Activation in the Brain and Neurological Disorders (especially autism)

This talk given by Dr Theoharides sponsored by The Autism Research Institute provides similar information to another interview with him that I have already published my notes for here, however this talk provides much more information and depth.  You may want to start with the other interview if this is new or overwhelming to you.  Here is more about Dr Theo (as he is affectionately called in the mast cell disease world) from the blurb for the talk "Theoharis Theoharides, MD, PhD is a professor of pharmacology, Internal Medicine and Biochemistry, and the director of the Laboratory of Molecular Immunopharmacology and Drug Discovery; Department of Pharmacology and Experimental Therapeutics, Tufts University School of Medicine. He trained in allergy and clinical immunology at Yale and internal medicine at New England Medical Center. Dr. Theoharides was director of medical pharmacology at Tufts (1986-1993), and became full professor in 1995. He has 300 publications and 3 books, including a Textbook of Pharmacology. Dr. Theoharides was the first to show mast cells and acute stress promote inflammation in autism, cancer, interstitial cystitis, migraines and multiple sclerosis."  So basically, he is NOT some "fringe" quack but rather an accomplished and well respected doctor and researcher whose groundbreaking work is changing the way that autism (among many other things) is understood within mainstream medicine.



Notes:

His central premise in this presentation is that autism, or at least a subset of cases of autism, is essentially an "allergy of the brain".  He tells us what allergies are, what causes them, why there could be an association with autism, and maybe even what we can do about it.  One of the cornerstone beliefs in western medicine has been that the brain does not "get" allergies.  However, many people with allergies do get neurological symptoms such as feeling irritable, having difficulty concentrating, even movement disorders such as tics following an exposure to an allergen.  The diencephalon is the part of the brain that "receives sensory stimuli and then sends them out to other parts of the brain, and then regulates the emotions that we generate against those sensory stimuli- and what do you know, most autistic children have behavior problems that relate to exactly that."  What prompted him to make the connection between autism and brain allergy is that the diencephalon has a high number of mast cells, which are immune cells that are at the center of allergic reactions..yet the brain doesn't get allergies?  Why would a cell that is thought to only be involved in allergic reactions be so plentiful in such an important region of the brain, when supposedly the brain doesn't get allergies?

First, we need to understand what allergies are.  "True" allergies occur when a specific thing that we are allergic to (an antigen) causes our bodies to produce IgE (immunoglobulin E), which then triggers the mast cells to react by degranulating, which means releasing large amounts of preformed mediators that were stored inside the cell.  Many children with autism appear to be allergic, meaning that they show symptoms that look like allergy, but do not test positive for allergies when tested using skin prick testing or RAST testing (looking for IgE in the blood).  He says that due to this many families with autistic children are sent home from the allergist's office being told that "it's all in their heads" when he emphatically states that this is NOT true- this is real.  Recently a new allergic disease has been identified called Mast Cell Activation Syndrome (MCAS) that explains this- a person with MCAS can have any or all of the symptoms of allergy but have no positive allergy testing at all.  One of the significant things about MCAS is that it is the first time that an allergic disease has neurological symptoms as part of it's description.

Mast cells were discovered in 1887 by Dr Paul Ehrlich.  He had no idea what the cells did- he thought they were feeding something because of the little granules inside of them.  About the same time, the term "anaphylaxis" was coined when two French researchers were doing experiments in which they injected dogs with ground up jellyfish tentacles in the hopes of causing immunity to the toxin.  They intended to call this effect "prophylaxis" which means "to protect", but when the dogs were re-injected with the toxin, rather than being protected as expected, they died.  The cause of death was then called "anaphylaxis" because the treatment had had the opposite effect.

An allergic reaction is when a mast cell is triggered by IgE and an antigen, which causes it to degranulate (or as he says) basically explode like a hand grenade.  Mast cells contain around 500 granules, which rupture and release their contents when triggered, which includes more than 50 chemicals.  We only have medicines to counter one of these chemicals, histamine, however he thinks that it's the other molecules that are more strongly associated with autism.  His lab was the first to show that mast cells could also release chemicals selectively, that is *without* degranulating (rupturing open), including chemicals that "can cause allergic-like reactions, inflammation, and sensitize neurons and cause neuronal damage" (when cells "leak" their contents in this way it will not show up on a biopsy the way a degranulated cell would).

In addition to IgE, other mast cell triggers include some components of the compliment system (associated with blood clotting, so anything that triggers clotting in the blood can trigger the mast cell), toxins released from bacteria and viruses, and more.  Other chemicals released from mast cells (called mediators) include leukotrienes (involved in asthma), cytokines, chemokines, TNF (tumor necrosis factor, which is a major player in Rheumatoid Arthritis), and more.  Interestingly, even in the same sample not all of the mast cells will react to the same stimulus...so what causes this heterogeneous response?  If we can figure out why some cells are not reacting it may lead to treatment options.

Mast cells also have a wide repertoire of molecules used for communication with other cells in the immune system, as well as pathogens including bacteria, viruses, parasites, and fungi.  Mast cells actually orchestrate the immune response to an immune trigger (an allergy is when the mast cell reacts to an otherwise harmless substance as if it were an invading pathogen).  Mast cells are associated with many other diseases including Multiple Chemical Sensitivities, Chronic Fatigue Syndrome, Fibromylagia, Interstitial Cystitis, and more.  He notes that these disorders are all relatively newly recognized and are increasing along with autism, further evidence that they may share physiology.  He also makes the point that we are also having an epidemic of asthma, despite better treatments, better knowledge, better air filters, and better vacuum cleaners.  So clearly something has been going on recently to drive an increase in allergic diseases.  Why are all of these diseases getting worse?  Do they share a commonality?

He believes the mast cell is the "canary in the coalmine" of the body.  Mast cells have existed phylogenetically (in all species) from long before we had a brain or an immune system.  They must have an important role in sensing the environment in order to be maintained by evolution so strongly.  They are also all over the body- in the gut, the skin, our eyes, our tongue, and of course in our brain (around 15:00 he discusses how mast cells in the brain activate cells differently than in the rest of the body).  He believes that they are there to sense danger and to help the body respond.  The recent rise in allergic (and inflammatory) diseases indicates that something has changed- either the mast cells are over-reacting to stimuli because they are somehow lacking what they need to function properly, and/or because they are being bombarded with too many stimuli to respond appropriately to each one.

His lab tested to see if mercury can stimulate mast cells and found that yes, mercury induces inflammatory mediator release from human mast cells.  He makes the point that mercury is in many things in addition to vaccines (and yes it is still in some), it is also in fish and some pesticides, for example.  They also found that if the mast cells were exposed to both mercury and another chemical released from nerve cells during stress the toxic effect is synergistic (the mast cells release even more mediators).  It's possible then that brain allergy results from more than one toxin, it may be the result of a combination of toxins that have a synergistic effect.

Are there mast cells in the brain?  Mast cells: the immune gate to the brain.  Mast cells are a critical part of the blood brain barrier.  They can be seen wrapped around blood vessels in the brain, with the job of protecting our brains from the toxins that might have made it into our bloodstreams.  Mast cells, along with red blood cells and endothelial cells, regulate the blood-brain-barrier (BBB).  Mast cells in the brain don't get triggered by allergens, they get triggered by other things.  Research also shows that mast cells are the most numerous in the brain during very early development.  So not only are they the most concentrated in the part of the brain very likely to be central to autism symptomatology, but they are also the most numerous at the time that autism sets in.  Also, mast cells are so close to nerves- sometimes even wrapped around them- that when they release their contents it can't but effect the nerves and damage them.

Most mast cell granules contain the enzyme tryptase which acts as a meat tenderizer.  If tryptase is released onto a neuron he believes that it kills the neuron, and that this is part of what is happening in the diencephalon in autism.  This is why he calls it a "focal brain allergy", because the reaction is not happening throughout the brain, but rather in those areas that are particularly important for social behavior and language.  It's known that many kids with autism do not do well with stress, and it has also been observed in the evidence that children born to mothers who were very stressed during pregnancy are more likely to have children with autism.  CRH is the first hormone in the brain released when we are under stress (it is what triggers the fight/flight response) and his lab found that mast cells are located near the neurons that release this hormone.  They found that the extreme states of stress that people with autism can get into can and do trigger mast cells to react.

From this point on in the presentation he presents many research articles, some from his lab and some done by other researchers.  These include:

Mast cells and inflammation
This paper establishes that mast cells drive inflammation, which he describes as the extreme form of allergy.  

Corticotropin-Releasing Hormone and Brain Mast Cells Regulate Blood-Brain-Barrier Permeability Induced by Acute Stress
A lot of children with autism have symptoms including food allergies, food intolerances, skin eruptions, brain fog, elevated levels of certain markers of brain inflammation (such as IL6 and TNF), intolerance of stress, lack of eye contact, loss of speech, reduced social engagement, and mitochondrial dysfunction.

Autism spectrum disorders: concurrent clinical disorders.
Found a high degree of correlation between eczema and autism and ADHD.

Cognitive function of 6-year old children exposed to mold-contaminated homes in early postnatal period. Prospective birth cohort study in Poland.
Found that children who were allergic to mold from these exposures had a lot of trouble with cognitive function.  In the US these kids would be called autistic.  Mold is not a typical allergen but it does stimulate mast cells.  

He says "So we're talking about environmental toxins, we're talking about mercury, we're talking about mold, we're talking about stress, put them all together, now we're having a crisis."

So he pulled all of this together and wrote a review...
Mast cell activation and autism

Research has shown that in mice acute stress (being confined in a small space) causes the BBB to open up after just 30 minutes of stress.  In genetically altered mice that do not have mast cells there is no breakdown of the BBB from stress.  Both types of mice released the same amount of cortisol from the stress so that wasn't the factor.  There is also direct evidence because they have found receptors on the surface of mast cells for the CRH.
Mast cells as targets of corticotropin-releasing factor and related peptides.

Mast cells also line the gut-blood barrier.  They are also in the Broca area that regulates language.  

He then goes on the hypothesize a fascinating connection between mast cell activation and mitochondrial dysfunction, which is another common finding in people with autism.  Mitochondria used to be bacteria WAY in the past but evolved to live synergistically with our own cells.  If they are to be destroyed they are destroyed in the cell by autophagy, they do not leave the cell.  He hypothesizes that if mitochondria or their components leave the cell the body will mistake them as an infection and will mount a massive immune inflammatory response.  So in autism not only is there the allergic-like symptoms, but also a mistaken "pathogen-fighting" response.  I wonder if this could be why MCAS and PANDAS can look so much alike?

Human mast cell degranulation and preformed TNF secretion require mitochondrial translocation to exocytosis sites: relevance to atopic dermatitis.
This research showed that mitochondria can move.  Once the mast cell is activated the mitochondria move to the cell surface.  The mito also broke down into smaller pieces. 

Stimulated Human Mast Cells Secrete Mitochondrial Components That Have Autocrine and Paracrine Inflammatory Actions
The little mitochondria are released outside the cell when mast cells are triggered.  

Mitochondrial DNA is very different than genomic DNA.  Extracellular mitochondrial components cause neutrophils and mast cells to release inflammatory mediators (IL5?), and cause neurons to die.  

Mitochondrial DNA Toxicity in Forebrain Neurons Causes Apoptosis, Neurodegeneration, and Impaired Behavior 

He found that the level of mito DNA in the serum of autistic children is highly elevated.  

Extracellular Mitochondrial Components Secreted from Activated Live Mast Cells Act as “Innate Pathogens” and Contribute to Autism Pathogenesis

Microglia and mast cells: two tracks on the road to neuroinflammation.
Mast cells work together with the microglia, the brain's primary immune cells.

Abnormal microglial-neuronal spatial organization in the dorsolateral prefrontal cortex in autism.

Most common genetic finding in autism has to do with a molecule called PTEN, which regulates another molecule called mTOR.  (from SnapShot: Genetics of Autism)  (I will update this post to include more information on this topic)

Activation and function of the mTORC1 pathway in mast cells.
mTOR has a high association with autism, so the genes most associated with autism are also governing mast cells.  mTOR means "mammalian target of rapamycin" which was an old antibiotic.  Rapamucin blocks mTOR.  Luteolin is an even more potent blocker of mTOR.  

PTEN deficiency in mast cells causes a mastocytosis-like proliferative disease that heightens allergic responses and vascular permeability.

Luteolin is a mast cell inhibitor.

Luteolin reduces IL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1.

Luteolin protects dopaminergic neurons from inflammation-induced injury through inhibition of microglial activation.

Flavonoids, a prenatal prophylaxis via targeting JAK2/STAT3 signaling to oppose IL-6/MIA associated autism.Focal brain inflammation and autism.

Focal brain inflammation and autism.





Sunday, April 17, 2016

Dairy-free Flan (Spanish custard)



This simple recipe for flan is based on one I found in an old Mexican cookbook.  My husband was amazed at how authentic this recipe tasted despite the changes, and the texture was spot-on.  I will add options for variations as I create and test them.  

INGREDIENTS:

2 c preferred milk substitute (I use unsweetened hemp milk)
3/4 c sugar or other granulated sweetener (I use coconut palm sugar)
4 eggs
1 tsp vanilla extract
pinch of salt

if caramelizing the mold:
1/3 cup sugar
2-3 T water

A Pyrex pie dish works well for the mold.  Anything round and shallow can work such as a cake pan or casserole dish.  

METHOD:

-preheat oven to 350 degrees.  

-(this step is optional, especially if you are needing to keep the sugar content low) To caramelize the mold, combine an additional 1/3 cup of sugar with 2-3 T of water in a saucepan and bring to a boil over medium heat until the sugar melts and turns caramel brown.  Pour the caramel into the bottom of your mold and swirl the mold around to coat the bottom and partway up the sides.  Set aside (you can let it sit upside down if the caramel is soft and starting to come back down the sides otherwise).

-Lightly beat the eggs in a large bowl, than slowly beat in the sugar until it is dissolved.  Add the milk, vanilla extract, and salt (if using animal milk scald it first then let it cool).  Pour this mixture into the mold.

-Place the filled mold into a larger pan (I use a large Pyrex lasagna pan) and fill with hot water to about halfway up the sides of the mold.  Bake for one hour or until a knife inserted in the middle comes out clean.  I find this works best with the oven rack set pretty low.


Thursday, April 7, 2016

Studies Show That Individual Responses to Vaccination Vary Widely

Variation in vaccine response in normal populations.
Pharmacogenomics. 2004 Jun;5(4):417-27.
"Genetic polymorphisms of the human leukocyte antigen (HLA) system significantly influence the variation in immune responses to viral vaccines. Considerable data on the genetic determinants of immune responses to the measles vaccine support the importance of HLA genes in determining the variation in vaccine response. HLA class I and class II, TAP, and HLA-DM allele associations with measles-specific antibody levels following measles vaccination have revealed, in part, the immunologic basis for mechanisms of measles immunity variation. Associations between HLA genotype and immune responses have also been reported for other vaccines and infectious diseases, such as hepatitis B and C, human papillomaviruses, and influenza. Vaccine pharmacogenomics may provide important insights for the design and development of new peptide-based vaccines against measles and other pathogens."

The link between genetic variation and variability in vaccine responses: systematic review and meta-analyses.
Vaccine. 2014 Mar 26;32(15):1661-9
"Although immune response to vaccines can be influenced by several parameters, human genetic variations are thought to strongly influence the variability in vaccine responsiveness. Systematic reviews and meta-analyses are needed to clarify the genetic contribution to this variability, which may affect the efficacy of existing vaccines. We performed a systematic literature search to identify all studies describing the associations of allelic variants or single nucleotide polymorphisms in immune response genes with vaccine responses until July 2013. The studies fulfilling inclusion criteria were meta-analyzed. Thirteen studies (11,686 subjects) evaluated the associations of human leukocyte antigen (HLA) and other immunity gene variations with the responses to single vaccines, including MMR-II (measles and rubella virus), HepB (hepatitis virus), influenza virus, and MenC (serogroup C meningococcus) vaccines. Seven HLA genetic variants were included in the meta-analyses... (W)hile our findings reinforce the concept that individuals with a particular HLA allelic composition are more likely to respond efficiently to vaccines, future studies should be encouraged to further elucidate the link between genetic variation and variability of the human immune response to vaccines."

Variability in Humoral Immunity to Measles Vaccine: New Developments.
Trends Mol Med. 2015 Dec;21(12):789-801
"Despite the existence of an effective measles vaccine, resurgence in measles cases in the USA and across Europe has occurred, including in individuals vaccinated with two doses of the vaccine. Host genetic factors result in inter-individual variation in measles vaccine-induced antibodies, and play a role in vaccine failure. Studies have identified HLA (human leukocyte antigen) and non-HLA genetic influences that individually or jointly contribute to the observed variability in the humoral response to vaccination among healthy individuals. In this exciting era, new high-dimensional approaches and techniques including vaccinomics, systems biology, GWAS, epitope prediction and sophisticated bioinformatics/statistical algorithms provide powerful tools to investigate immune response mechanisms to the measles vaccine. These might predict, on an individual basis, outcomes of acquired immunity post measles vaccination."

Predicting post-vaccination autoimmunity: who might be at risk?
Pharmacol Res. 2015 Feb;92:18-22.
"Vaccinations have been used as an essential tool in the fight against infectious diseases, and succeeded in improving public health. However, adverse effects, including autoimmune conditions may occur following vaccinations (autoimmune/inflammatory syndrome induced by adjuvants--ASIA syndrome). It has been postulated that autoimmunity could be triggered or enhanced by the vaccine immunogen contents, as well as by adjuvants, which are used to increase the immune reaction to the immunogen. Fortunately, vaccination-related ASIA is uncommon. Yet, by defining individuals at risk we may further limit the number of individuals developing post-vaccination ASIA. In this perspective we defined four groups of individuals who might be susceptible to develop vaccination-induced ASIA: patients with prior post-vaccination autoimmune phenomena, patients with a medical history of autoimmunity, patients with a history of allergic reactions, and individuals who are prone to develop autoimmunity (having a family history of autoimmune diseases; asymptomatic carriers of autoantibodies; carrying certain genetic profiles, etc.)."


Pediatr Infect Dis J. May 2009; 28(5): 431–432.
"With current and future technologic advances such as high throughput whole-genome scanning, transcriptomics, epigenetics, proteomics, and new biostatistical approaches to understanding huge databases of information, we can better understand associations and mechanisms by which genetically-mediated individual variations in vaccine response and reactivity occur. Armed with such knowledge, the ability to predict such AEs (adverse events), or to design new vaccine approaches that minimize or eliminate serious vaccine-related reactions could be devised, consistent with a more personalized or individual approach to vaccine practice which we have called adversomics (the immunogenetics and immunogenomics of vaccine adverse events at the individual and population level, respectively)...

We believe that adversomics (the immunogenetics and immunogenomics of vaccine adverse events at the individual and population level, respectively) is critical to understanding and preventing serious adverse vaccine-related events, developing the next generation of vaccines, and to improving public confidence in vaccine safety."


Vaccine immunogenetics: bedside to bench to population.
Vaccine. 2008 Nov 18;26(49):6183-8.
"The immunogenetic basis for variations in immune response to vaccines in humans remains largely unknown. Many factors can contribute to the heterogeneity of vaccine-induced immune responses, including polymorphisms of immune response genes. It is important to identify those genes involved directly or indirectly in the generation of the immune response to vaccines. Our previous work with measles reveals the impact of immune response gene polymorphisms on measles vaccine-induced humoral and cellular immune responses. We demonstrate associations between genetic variations (single nucleotide polymorphisms, SNPs) in HLA class I and class II genes, cytokine, cell surface receptor, and toll-like receptor genes and variations in immune responses to measles vaccine. Such information may provide further understanding of genetic restrictions that influence the generation of protective immune responses to vaccines, and eventually the development of new vaccines."

Heterogeneity in vaccine immune response: the role of immunogenetics and the emerging field of vaccinomics.
Clin Pharmacol Ther. 2007 Dec;82(6):653-64.
"Recent advances in the fields of immunology, genetics, molecular biology, bioinformatics, and the Human Genome Project have allowed for the emergence of the field of vaccinomics. Vaccinomics encompasses the fields of immunogenetics and immunogenomics as applied to understanding the mechanisms of heterogeneity in immune responses to vaccines. In this study, we examine the role of HLA genes, cytokine genes, and cell surface receptor genes as examples of how genetic polymorphism leads to individual and population variations in immune responses to vaccines. In turn, this data, in concert with new high-throughput technology, inform the immune-response network theory to vaccine response. Such information can be used in the directed and rational development of new vaccines, and this new golden age of vaccinology has been termed "predictive vaccinology", which will predict the likelihood of a vaccine response or an adverse response to a vaccine, the number of doses needed and even whether a vaccine is likely to be of benefit (i.e., is the individual at risk for the outcome for which the vaccine is being administered?)."

Expert Rev Vaccines. 2013 Jan;12(1):57-70.
"The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of 'vaccinomics' for novel vaccine development."

2'-5'-Oligoadenylate synthetase single-nucleotide polymorphisms and haplotypes are associated with variations in immune responses to rubella vaccine.
Hum Immunol. 2010 Apr;71(4):383-91
"Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine."

SNP/haplotype associations in cytokine and cytokine receptor genes and immunity to rubella vaccine.
Immunogenetics. 2010 Apr;62(4):197-210
"An effective immune response to vaccination is, in part, a complex interaction of alleles of multiple genes regulating cytokine networks. We conducted a genotyping study of Th1/Th2/inflammatory cytokines/cytokine receptors in healthy children (n = 738, 11-19 years) to determine associations between individual single-nucleotide polymorphisms (SNPs)/haplotypes and immune outcomes after two doses of rubella vaccine. SNPs (n = 501) were selected using the ldSelect-approach and genotyped using Illumina GoldenGate and TaqMan assays. Rubella-IgG levels were measured by immunoassay and secreted cytokines by ELISA. Linear regression and post hoc haplotype analyses were used to determine associations between single SNPs/haplotypes and immune outcomes. Increased carriage of minor alleles for the promoter SNPs (rs2844482 and rs2857708) of the TNFA gene were associated with dose-related increases in rubella antibodies. IL-6 secretion was co-directionally associated (p < or = 0.01) with five intronic SNPs in the TNFRSF1B gene in an allele dose-related manner, while five promoter/intronic SNPs in the IL12B gene were associated with variations in IL-6 secretion. TNFA haplotype AAACGGGGC (t-statistic = 3.32) and IL12B promoter haplotype TAG (t-statistic = 2.66) were associated with higher levels of (p < or = 0.01) rubella-IgG and IL-6 secretion, respectively. We identified individual SNPs/haplotypes in TNFA/TNFRSF1B and IL12B genes that appear to modulate immunity to rubella vaccination. Identification of such "genetic fingerprints" may predict the outcome of vaccine response and inform new vaccine strategies."

Rubella vaccine-induced cellular immunity: evidence of associations with polymorphisms in the Toll-like, vitamin A and D receptors, and innate immune response genes.
Hum Genet. 2010 Feb;127(2):207-21
"Toll-like, vitamin A and D receptors and other innate proteins participate in various immune functions. We determined whether innate gene-sequence variations are associated with rubella vaccine-induced cytokine immune responses. We genotyped 714 healthy children (11-19 years of age) after two doses of rubella-containing vaccine for 148 candidate SNP markers. Rubella virus-induced cytokines were measured by ELISA. Twenty-two significant associations (range of P values 0.002-0.048) were found between SNPs in the vitamin A receptor family (RARA, RARB, TOP2B and RARG), vitamin D receptor and downstream mediator of vitamin D signaling (RXRA) genes and rubella virus-specific (IFN-gamma, IL-2, IL-10, TNF-alpha, and GM-CSF) cytokine immune responses. A TLR3 gene promoter region SNP (rs5743305, -8441A > T) was associated with rubella-specific GM-CSF secretion. Importantly, SNPs in the TRIM5 gene coding regions, rs3740996 (His43Tyr) and rs10838525 (Gln136Arg), were associated with an allele dose-related secretion of rubella virus-specific TNF-alpha and IL-2/GM-CSF, respectively, and have been previously shown to have functional consequences regarding the antiviral activity and susceptibility to HIV-1 infection. We identified associations between individual SNPs and haplotypes in, or involving, the RIG-I (DDX58) gene and rubella-specific TNF-alpha secretion. This is the first paper to present evidence that polymorphisms in the TLR, vitamin A, vitamin D receptor, and innate immunity genes can influence adaptive cytokine responses to rubella vaccination."

"In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans."

The genetic basis for measles vaccine failure.
Acta Paediatr Suppl. 2004 May;93(445):43-6; discussion 46-7.
"The US measles epidemics of 1989-1991 included a series of outbreaks resulting from vaccine failure. A series of studies was launched aimed at elucidating the mechanisms of this vaccine failure. A meta-analysis of the literature examining epidemics in vaccinated populations was conducted, which showed that the secondary vaccine failure rate (development of the disease despite an initial or primary vaccine success) is no more than 0.2%. The overwhelming proportion of measles vaccine failure was due to primary vaccine failure (failure to ever generate antibody from antigenic stimulation). This comparison of two geographically distinct communities revealed that 10% of children previously vaccinated against measles lacked antibody on follow-up and that these vaccine failures clustered in families. A study of monozygotic and dizygotic twins revealed a high degree of heritability of measles vaccine antibody level. Subsequent studies found associations with both class I and class II alleles in these population-based studies. In the future, detection of the specific peptides that interact with human leukocyte antigen (HLA) molecules may serve as the basis for improved vaccines and address vaccine failure that results from cold-chain problems, immaturity of the immune system, malnutrition and maternal immunity."

"Febrile seizures represent a serious adverse event following measles, mumps and rubella (MMR) vaccination. We conducted a series of genome-wide association scans comparing children with MMR-related febrile seizures, children with febrile seizures unrelated to vaccination and controls with no history of febrile seizures. Two loci were distinctly associated with MMR-related febrile seizures, harboring the interferon-stimulated gene IFI44L (rs273259: P = 5.9 × 10−12 versus controls, P = 1.2 × 10−9 versus MMR-unrelated febrile seizures) and the measles virus receptorCD46 (rs1318653: P = 9.6 × 10−11 versus controls, P = 1.6 × 10−9 versus MMR-unrelated febrile seizures)."

Effects of vitamin A and D receptor gene polymorphisms/haplotypes on immune responses to measles vaccine.
Pharmacogenet Genomics. 2012 Jan;22(1):20-31
"Our results suggest that specific allelic variations and haplotypes in the vitamin A receptor and VDR genes may influence adaptive immune responses to measles vaccine."
Vaccine. 2011 Oct 19;29(45):7883-95
"Identification of host genetic determinants of measles vaccine-induced immunity can be used to design better vaccines and ultimately predict immune responses to vaccination. We performed a comprehensive candidate gene association study across 801 genetic markers in 56 cytokine/cytokine receptor genes, in a racially diverse cohort of 745 schoolchildren after two doses of MMR vaccine. Using linear regression methodologies we examined associations between SNPs/haplotypes and measles virus-specific immunity. Forty-eight significant SNP associations with variations in neutralizing antibodies and measles-specific IFNγ Elispot responses were identified (p<0 .05="" a="" african-americans.="" an="" analysis="" and="" associated="" association="" associations="" but="" caucasian="" caucasians="" cellular="" confirmed="" demonstrated="" determinants="" elispot="" findings="" found="" functional="" genetic="" global="" group="" haplotype="" hr244ile="" humoral="" i="" identify="" il10="" il12b="" il2="" il7r="" immune="" immunity="" important="" in="" including="" level="" manner.="" measles-specific="" measles="" multiple="" new="" non-synonymous="" not="" of="" or="" our="" p-value="0.003)." p="" plausible="" polymorphisms="" previous="" previously="" promoter="" race-specific="" regulating="" replicated="" reported="" responses="" results="" rs1800890="" rs2069762="" rs3212227="" rs6897932="" similarly="" snp="" study="" the="" two="" vaccine-induced="" validate="" variant="" variants="" variations="" were="" with="">

Vaccine. 2004 May 7;22(15-16):1914-20."Associations between human leukocyte antigen (HLA) genes and very high levels of antibodies (or hyperseroresponsiveness) to measles antigens in a genetically heterogeneous human population are poorly understood. We studied the association between antibody levels after measles vaccination and HLA class I and II alleles among 170 US schoolchildren who received one dose of measles-mumps-rubella II vaccine. Vaccine recipients were divided into two groups: 93 recipients who were seropositive and 77 recipients who were hyperseropositive (the upper 10th percentile of antibody levels of all subjects). Out of all the alleles analyzed, HLA-B(*)7 (odds ratio (OR) 1.9; P = 0.05), DQA1(*)0104 (OR 4.6; P = 0.02) and DPA1(*)0202 (OR 4.8; P = 0.04) alleles were positively associated with hyperseropositivity, whereas HLA-B(*)44 (OR 0.4; P = 0.02), DRB1(*)01 (OR 0.6; P = 0.09), DRB1(*)08 (OR 0.3; P = 0.04), DQB1(*)0301 (OR 0.5; P = 0.04), and DPB1(*)0401 (OR 0.6; P = 0.03) alleles were negatively associated with hyperseropositivity. The alleles B(*)44, DRB1(*)01, DRB1(*)08 and DQA1(*)0104 remained statistically significant after accounting for the effects of other alleles. The results suggest that HLA alleles have important associations with measles antibody hyperseropositivity. These data increase our understanding of measles vaccine-induced immune response and will be useful for future mechanistic work on measles virus antigen processing and presentation in seronegative and hyperseropositive individuals."

Hum Hered. 2011;72(3):206-23."A previously detected association of the CD46 SNP rs2724384 with measles-specific antibodies was successfully replicated in this study. Increased representation of the minor allele G for an intronic CD46 SNP was associated with an allele dose-related decrease (978 vs. 522 mIU/ml, p = 0.0007) in antibody levels. This polymorphism rs2724384 also demonstrated associations with IL-6 (p = 0.02), IFN-α (p = 0.007) and TNF-α (p = 0.0007) responses. Two polymorphisms (coding rs164288 and intronic rs11265452) in the SLAM gene that were associated with measles antibody levels in our previous study were associated with IFN-γ Elispot (p = 0.04) and IL-10 responses (p = 0.0008), respectively, in this study. We found associations between haplotypes, AACGGAATGGAAAG (p = 0.009) and GGCCGAGAGGAGAG (p < 0.001), in the CD46 gene and TNF-α secretion.

Understanding the functional and mechanistic consequences of these genetic polymorphisms on immune response variations could assist in directing new measles and potentially other viral vaccine design, and in better understanding measles immunogenetics."

Hum Genet. 2011 Oct;130(4):547-61."Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines."

The association of class I HLA alleles and antibody levels after a single dose of measles vaccine.
Hum Immunol. 2003 Jan;64(1):103-9."Despite the success of the current measles vaccine in controlling disease in industrialized countries, the importance of vaccine failure has become increasingly apparent. Our objective was to determine if associations exist between seronegativity after measles vaccination and class I human leukocyte antigen (HLA) alleles. We undertook a cross-sectional observational study in Rochester, Minnesota, with 242 school-age children previously recruited from a communitywide seroprevalence study. We studied two groups of subjects: 72 were seronegative (EIA < or =0.8 after a single dose of measles vaccine) and 170 were seropositive (enzyme immunoassy [EIA] > or =1.0 after one dose). We used the resources of Mayo Clinic's tissue typing laboratory for serotyping class I HLA-A and HLA-B alleles via microlymphocytotoxicity assays. We found no statistically significant associations with class I HLA-A but did find associations with class I HLA-B, which includes alleles associated with seronegativity (B8, B13, and B44) and those associated with seropositivity (B7 and B51). Elucidation of the specific peptide-HLA complex interactions that lead to varying or failed immune responses may provide fertile groundwork for improved vaccines that can overcome limitations of the current live, attenuated measles vaccine."

The association between HLA class I alleles and measles vaccine-induced antibody response: evidence of a significant association.
Vaccine. 1998 Nov;16(19):1869-71."While the Moraten strain measles vaccine is an excellent, safe, and immunogenic vaccine, vaccine failure occurs, presumably when an individual develops an inadequate immune response. In this study, we examined the association of HLA class I genes and measles vaccine-induced antibody levels. We found that the allele distribution of HLA-B alleles differed between non-responders and hyper-responders (p = 0.002). Several class I alleles were associated with non-response (HLA-B13, -B44, and -C5); whereas several other alleles were associated with hyper-response (HLA-B7 and -B51). In addition, non-responders were more likely to be HLA-B homozygous than normal responders (odds ratio 2.1), and more likely to be homozygous than hyper-responders (odds ratio 3.7, p = 0.031 Mantel-Haenzel for trend). Finally, we found evidence of an allele dose-response phenomenon for HLA-B7. We conclude that there are important associations between class I HLA genes and measles antibody levels following immunization."

J Investig Med. 1996 Jun;44(5):261-3."The distribution of HLA-DRB1 alleles among nonresponders compared to hyper-responders was significantly different (p = 0.014). Nonresponders were significantly less likely to carry the HLA-DRB1*13 alleles than were hyper-responders (7.4% vs 16.2%;p = 0.02). Nonresponders also had an excess of HLA-DRB1*07 alleles (15.4% vs 6.2%; p = 0.015).

The absence of HLA-DRB1*13 alleles is associated with measles vaccine nonresponse. The absence of this allele has also been associated with susceptibility to other infectious diseases. The role of this gene in the immunogenetic response to infectious diseases requires further study."

Relationship of HLA-DQA1 alleles and humoral antibody following measles vaccination.
Int J Infect Dis. 1998 Jan-Mar;2(3):143-6."HLA-DQA1 alleles have important associations with the antibody response to measles vaccine. Specifically, the carriage of the HLA-DQA1*05 alleles is associated with nonresponse and that of HLA-DQA1*01 alleles with hyperresponse. In addition, HLA-DQA1 homozygosity is significantly associated with poor antibody response to measles vaccine."

Differential HLA gene expression in measles vaccine seropositive and seronegative subjects: a pilot study.
Scand J Infect Dis. 2003;35(5):332-6."This is the first study using GeneChip technology to elucidate genetic determinants of the measles vaccine response. A comparative gene expression study was conducted using Affymetrix's Human GeneChip U-95A in 5 human subjects immunized with a 'booster' dose of measles vaccine (Attenuax, Merck) to determine whether serologically distinct subjects exhibit differential expression of human leukocyte antigen (HLA) genes. Healthy individuals aged 15-25 y, previously immunized with 2 doses of measles-mumps-rubella-II (MMR-II) vaccine, were classified as measles vaccine immunoglobulin G-specific antibody seronegatives (n = 2) and seropositives (n = 3). Changes in expression of HLA genes in seronegatives and seropositives were studied on days 7 and 14 post-measles vaccination using Microarray Suite 5.0 (MAS 5.0). There was increased expression of the HLA class I-B (p = 0.0002), HLA class II cluster of DMA, DMB, TAP1, TAP2 (p = 0.0007) and HLA-DR (p = 0.0001) genes, and decreased expression of HLA class I MICB molecule (p = 1), HLA class I-A (p = 0.9999) and major histocompatibility complex class III HSP 70 (p = 0.9999) genes on day 7 or day 14 postvaccination in seropositives compared with seronegatives. These results suggest an association between antibody response and differential HLA gene activation and may explain one potential mechanism underlying measles vaccine non-response."

Polymorphisms of the TAP2 gene may influence antibody response to live measles vaccine virus.
Vaccine. 1997 Jan;15(1):3-6."These data reveal an association between TAP2 genotype and measles vaccine antibody response which may explain one mechanism behind vaccine failure."


Wednesday, March 9, 2016

Gleevec (Imatinib)

Gleevec is the brand name for the drug Imatinib ( imatinib mesylate) which is a tyrosine kinase inhibitor (TKI for short).  TKIs are a form of targeted chemotherapy, and Gleevec was originally developed to treat a rare type of leukemia called chronic myelogenous leukemia (CML).  It is now used to treat certain forms of leukemia, a type of intestinal tumor called a stroma, and Mast Cell Disease and sometimes Eosinophilic diseases as well.  For some mast cell patients it is a miracle drug (fro others not so much).  Until this month (February of 2016) it was still under patent so could not be compounded which made it a catch-22 for mast cell patients- it is only considered for very sick patients, but because it could not be compounded these same patients rarely tolerated the drug without serious side effects.  These side effects can be severe enough to require the patient to be hospitalized long term and are often severe enough to make the medicine not an option.  Now that it is not under patent many of us are hoping that this situation will change.

Gleevec is a drug that has a very narrow mode of action, and was developed for a disease other than MCAS, so how does it work in MCAS?  This quote is from a presentation by Dr Afrin and explains what is known about this question "I suspect the reason imatinib can work in some patients with the
D816V mutation is that most of these patients have multiple mutations. We know imatinib can stabilize some of the other mutations, i.e., it doesn’t focus just on the D816V mutation. We don’t exactly know the molecular mechanism yet of how it stabilizes the other mutations or which ones. The fundamental issue with mutations is that although KIT is ordinarily quiescent until it gets activated by stem cell factor, these mutations lead to constitutive activation of KIT. Once KIT is always on, you’ve got to find a way to stabilize it."

KIT is a protein that is expressed on the surface of some types of cells, and once activated by SCF (Stem Cell Factor), it activates pathways in the cell that regulate cellular growth, division, survival, and movement.  Somatic mutations in a gene are mutations that are acquired since birth, not ones that are inherited.  Somatic mutations in KIT can create a signalling protein in the cell that does not need the KIT receptor on the cell's surface to be activated- the mutated protein results in a pathway that is constantly turned "on".  Cells that express KIT (also called CD 117) on their surface include mast cells, melanocytes (cells that produce melanin, then most common pigment of eyes, hair, and skin), reproductive cells (germ cells), and cells in the GI tract called interstitial cells of Cajal (ICCs).  Interestingly ICCs are involved in peristalsis, the movement of food through the GI tract, and many people with MCAS have problems with this.

Whether or not Gleevec actually counts as a chemotherapy drug is a semantic debate.  Chemotherapy drugs are usually thought to be drugs that kill cells, while Gleevec is an example of a drug that works via targeting specific proteins in the cell rather than killing it- called targeted therapy.  It was developed to treat certain forms of cancer which is part of why it is associated with chemotherapy.  It does appear to be safer than the older, non-targeted chemo agents that affected large amounts of body systems and have many side effects.  As a relatively new drug I do not think that the safety profile has been fully understood yet.  Similar drugs include Dasatinib and Sunitinib (which targets and inhibits vascular endothelial growth factor).

Sources and Further Reading:

Gleevec: the Breakthrough in Cancer Treatment

How Gleevec Works

Imatinib

Side Effects:

Patients Taking Imatinib for CML Have Similar Risk of Death as General Population

Principal long-term adverse effects of imatinib in patients with chronic myeloid leukemia in chronic phase
"IM is associated with toxicity, though most of the adverse effects attributed occur within the first 2 years of starting therapy and some reverse with continued treatment at the same dose. Toxicity appears mild to moderate in most instances and appears easily manageable and potentially reversible. Some patients may experience lethargy and develop different types of rashes; others gain weight from fluid retention, especially infraorbital edema but occasionally much more generalized, which responds in some cases to diuretics. Other effects include bone pain, which can sometimes be debilitating. Liver chemistry can be abnormal, and this may, on rare occasions, progress to liver failure. Rare incidences of prolongation of the QTc interval on the electrocardiograph have been reported. A small proportion of patients in CP who start IM at 400 mg/day experience cytopenias within the first year of therapy. They typically develop neutropenia and/or thrombocytopenia and sometimes anemia."

In Mast Cell Disease:

This is a presentation given by Dr Afrin in which he discusses a number of cases in which Gleevec was given and resulted in dramatic improvement.  The presentation itself if very long (153 pages) and covers a lot of ground, but the case histories are interesting.

This is a blog post from another MCAD patient whose disease is very far progressed.  In this post she discusses her choice to begin the medication, how she and her medical team have gone about administering it, and what the results have been.

Imatinib Mesylate in the Treatment of Systemic Mastocytosis: a phase ll trial
"Mastocytosis is characterized by the abnormal proliferation of mast cells in 1 or more organs. In most patients, a mutation is present in the gene for C-KIT, resulting in deregulation of the c-kit receptor. Imatinib mesylate is a potent inhibitor of c-kit receptor tyrosine kinase activity. Therefore, the authors evaluated the efficacy and safety of imatinib mesylate as treatment for patients with systemic mastocytosis.  

Patients with systemic mastocytosis received imatinib mesylate orally at a dose of 400 mg once daily for 3 to 6 months. Low doses of prednisone were added during the first 2 weeks. Endpoints were reductions in serum tryptase, urinary N-methylhistamine excretion, skin lesions, the number of mast cells in bone marrow sections, hepatomegaly and/or splenomegaly, and symptoms.


Of 14 patients who were included in the study, 11 patients had the D816V mutation. One patient expressed the FIP1L1-PDGFR-alpha rearrangement gene. In 2 patients, no mutation was found. In 10 patients, serum tryptase levels decreased >20%. In all patients, urinary N-methylhistamine excretion was reduced. In 8 of 13 evaluable patients, the number of mast cells in the bone marrow decreased. Skin symptoms diminished in 5 of 9 patients. Hepatosplenomegaly improved in 3 of 6 patients. Symptoms decreased in 8 of 13 patients. In all patients who had the D816V mutation, reductions in > or =2 endpoints were achieved. In the patient who expressed the FIP1L1-PDGFR-alpha rearrangement gene, a complete response was attained. In general, imatinib mesylate was tolerated well."

bcr-abl-Induced Cell Lines Can Switch From Mast Cell to Erythroid or Myeloid Differentiation In Vitro
" Engraftment of mice with bone marrow cells infected with a bcr-ab1 retrovirus has been shown to elicit multiple hematopoietic disorders, including a clonal but nontransplantable hyperproliferation
of erythroid and/or mast cells. Culture of spleen and bone marrow cells from such mice usually yielded mast cell lines, even when erythroid disease dominated the primary animal. The mast cells, which carried the same proviral insert as the primary disease, generally grew slowly and were neither transplantable nor clonogenic in agar until they had been cultured for several months. Unexpectedly, several bcr-ab/-induced lines switched in vitro from mast cell to megakaryocytic and/or erythroid character, and one became myeloid. The dramatic phenotypic shifts seem likely to involve changes occurring within progenitor cells maintaining the clone, rather than mutation of mature mast cells. The variant lines exhibited substantial spontaneous differentiation, despite being readily ransplantable and therefore fully transformed. The production of hematopoietic growth factors by the mast cell lines and their phenotypic variants may implicate an autocrine loop in their evolution."

Long-term treatment with imatinib results in profound mast cell deficiency in Ph+ chronic myeloid leukemia.
"We examined the in vitro- and in vivo effects of the KIT-targeting drug imatinib on growth and development of human MC. Imatinib was found to inhibit stem cell factor (SCF)-induced differentiation of MC in long-term suspension cultures (IC50: 0.01 µM). Correspondingly, long-term treatment of chronic myeloid leukemia (CML) patients with imatinib (400 mg/day) resulted in a marked decrease in MC. In patients with continuous complete molecular response during therapy, bone marrow MC decreased to less than 5% of pre-treatment values, and also serum tryptase concentrations decreased significantly (pre-treatment: 32.0 ± 11.1 ng/ml; post-therapy: 3.4 ± 1.8, p<0 .01="" a="" accompanied="" adverse="" affected="" also="" and="" are="" assumed="" attributable="" by="" clinical="" cml="" decrease="" depletion="" develop="" drug-induced="" events="" far.="" healthy="" homeostasis="" however="" i="" imatinib-therapy.="" imatinib="" in="" independently="" is="" kit="" known="" less="" lineages="" mc-deficiency="" mc-development="" mc="" mice.="" myeloid="" no="" not="" of="" other="" our="" patients.="" produced="" production="" recorded="" relevant="" so="" substantial="" suggesting="" suppresses="" syndrome="" than="" that="" tissues="" to="" together="" vitro="" vivo.="" was="" we="" were="">

The tyrosine kinase network regulating mast cell activation.
"Mast cell mediator release represents a pivotal event in the initiation of inflammatory reactions associated with allergic disorders. These responses follow antigen-mediated aggregation of immunoglobulin E (IgE)-occupied high-affinity receptors for IgE (Fc epsilon RI) on the mast cell surface, a response which can be further enhanced following stem cell factor-induced ligation of the mast cell growth factor receptor KIT (CD117). Activation of tyrosine kinases is central to the ability of both Fc epsilon RI and KIT to transmit downstream signaling events required for the regulation of mast cell activation. Whereas KIT possesses inherent tyrosine kinase activity, Fc epsilon RI requires the recruitment of Src family tyrosine kinases and Syk to control the early receptor-proximal signaling events. The signaling pathways propagated by these tyrosine kinases can be further upregulated by the Tec kinase Bruton's tyrosine kinase and downregulated by the actions of the tyrosine Src homology 2 domain-containing phosphatase 1 (SHP-1) and SHP-2. In this review, we discuss the regulation and role of specific members of this tyrosine kinase network in KIT and Fc epsilon RI-mediated mast cell activation."

Successful treatment of mast cell activation syndrome with sunitinib
"Mast cell (MC) activation syndrome (MCAS) is a recently recognized, likely prevalent collection of heterogeneous illnesses of inappropriate MC activation with little to no MC neoplasia likely driven by heterogeneous patterns of constitutively activating mutations in MC regulatory elements including various tyrosine kinases (TKs, dominantly KIT). MCAS typically presents as chronic multisystem polymorbidity of generally inflammatory ± allergic theme. As with indolent systemic mastocytosis (SM), treatment of MCAS focuses more against MC mediators than MC neoplasia, but some cases prove refractory even to the TK inhibitor (TKI) imatinib reported useful both in uncommon SM cases not bearing SM's usual imatinib-resistant KIT-D816V mutation and in some cases of MCAS (which rarely bears KIT-D816V). Most allergy is principally a MC activation phenomenon and sunitinib is a multitargeted TKI shown helpful in controlling a murine model of oral allergy syndrome. We present the first report of use of sunitinib in life-threatening MCAS refractory to multiple agents including imatinib achieving immediate, complete, sustained, non-toxic remission suggesting a new option for treatment of aggressive MC disease."

Complete Response After Imatinib Mesylate Therapy in a Patient With Well-Differentiated Systemic Mastocytosis


Sunday, February 7, 2016

Trauma and PTSD

In several earlier posts I talk about the new perspective that childhood trauma is a major (if not THE major) risk factor for disease later in life.  So far evidence suggests this is due to epigenetic changes as well as mast cell effects, but there are probably more connections that will be discovered as well.  Since trauma is such a critical piece of the puzzle it is something that we need to understand better.  Also, many of us with chronic diseases develop medical PTSD and parents of kids with autism and other developmental disorders can develop PTSD from watching our kids being injured and struggle.  This TED talk by Dr. Megan McElheran is an extremely good description of what trauma and PTSD are:



“Trauma has the effect of organizing the lives of trauma survivors into life pre-trauma and life post trauma.  Life post trauma involves knowing things that perhaps before were not known at all, or only minimally known or acknowledged.  Life post-trauma means having come into contact with the knowledge of certain things, like mortality, that once having contacted or experienced, can no longer be ignored or denied."

"The experience I just described was equivalent to a tectonic shift for the individual for whom it occurred.”  

“To experience something like I described, is to come into contact with unparalleled psychological and emotional pain.”  The impulse is to get away from the pain and to distance ones self.  What happens when you pull away from your own emotional feelings is a profound alienation from yourself, your world, and others.  This results in pervasive avoidance, mood instability, low quality of life.  Emotional numbing occurs.  Humans are intrinsically social creatures and being alienated from that, having that cut off, is life-threatening.  It’s a vicious cycle.  Trauma fundamentally involves disconnection.  

“What people are forced to wrestle with in the aftermath of a traumatic event is how to reconstruct a life, and a worldview, when what used to be there has been shattered.”  There is no more taking things for granted.  PTSD involves dysfunctional attempts to reassert control in one's life.  By the time people seek treatment they have narrowed the range of their existence.  People rarely leave the house, have lost contact with friends and sometimes all of their family members.  They think to themselves “If I control my world in this way, I will be physically and emotionally safe.”  The outside world becomes very dangerous and out of control.  

“The urge to pull away from pain is instinctual.”  It is a normal reaction to abnormal events. 


The solution is re-engagement.  Re-engage with yourself and with those around you.  No one specific treatment makes people heal…”Healing happens in the context of a connection with another human being, when qualities of safety, empathy, and genuine understanding are present.”  Therapy only works in the context of this kind of relationship.  People can endure and heal from horrific events if they have even one person that they can connect with.  Recovery can be transformational, like a a caterpillar turning into a butterfly.  “It is the struggle to re-emerge that is crucial to the process of transformation.”  Without the struggle the new entity will not appear.  

Trauma is made worse by the happiness myth- if we are not happy all the time, something is wrong.  Sometimes life doesn't work that way, sometimes we need to face hard things and not be happy in order to heal.   

Probiotics for Specific Conditions

The book A Mother's Guide To Probiotics has information about which strains of probiotics are suited to which specific health needs and diseases.

Probiotic Advisor is a fee-based service with access to evidence-based information about probiotics.
"ProbioticAdvisor.com provides independent, unbiased, evidence-based information on probiotics, their potential risks, and documented benefits."

Some people may need to reduce or avoid intake of d-lactate producing probiotics, because in some people the d-lactate can build up and cause the person to switch from aerobic to anaerobic respiration (this means the mitochondria produce much less energy).  For more on this read this post from the blog Mommypotamus. (L.acidophilis mainly produces d-lactate).  "Low ATP can affect cognitive function, create feelings of fatigue and impair coordination among other things. More generally, symptoms of D-Lactic acidosis include fatigue, confusion, impaired central nervous system function, impaired coordination, depression, nausea, vomiting, anxiety, anemia, headaches and in extreme cases encephalopathy."  Custom Probiotics has a d-lactate-free formulation.

It is best to avoid strep strains for people with PANDAS as they may trigger a flare.  S. Thermophilus seems to be the most common strep strain and is in many preformulated probiotic products.

There are several blog posts out there with lists of which probiotics are supposed to help certain conditions.  These can be like "cheat sheets" if you trust the blogger.  This is one from The Healthy Home Economist, and this is a list someone posted on a forum that I am intending to research further myself.

The Low Histamine Chef also has a post about probiotics that lower histamine levels and are anti-inflammatory here.  In her post she claims that "L. paracasei probiotic can reverse the gut permeability" and "stress can also cause bacteria to cling to the gastrointestinal tract, but this bacteria was prevented from sticking to the mesenteric lymph nodes (in this study) by a mixture of L. rhamnosus and Lactobacillus helveticus ". She also says that "Lactobacillus plantarum (lowers/inhibits tyramine and putrescine but no effect on histamine)" She recommends Bifidobacterium infants, Bifidobacterium longum, Bifidiobacterium breve, and Lactobacillus reuteri.

"The probiotic Lactobacillus rhamnosus (and a few others) down-regulate the IgE and Histamine 4 receptor while also up-regulating anti-inflammatory agents like (IL)-8. In English (to quote a group friend): the probiotic turns down the dial on two important allergy/mast cell cell/histamine receptors, while enhancing the activity of anti-inflammatory agents.

Allergy information (this is not complete):

BioKult may contain traces of soy and milk from the growth medium.
PureEncapsulations ProbioMood contains milk.
Xymogen Probio Defense contains soy and milk (seems to contain some corn)
Standard Process ProSynbiotic contains milk and maltodextrin (probably corn).
Culturelle contains maltodextrin and some products contain artificial colors.
Custom Probiotics *may* be grown on corn.
BioRay products often contain maltodextrin.
Florastor contains milk and some products contain artificial flavors.
Theralac contains milk.
Some Garden of Life products contain oat grass and barley grass, another has banana, milk, and fish.
Threelac contains lemon and yeast.
VSL #3 unflavored has cornstarch.

Pure Encapsulations has a soy and dairy free product called Probiotic 50B.
Pure Encapsulations PureProbiotic (allergen-free)
Seeking Health brand seems to be pretty allergy friendly.
Kirkman brand has many different probiotic products, some are allergy-friendly.
Enzymedica ProBio is free of major allergens and has no fillers.  It does contain several strains that we will be avoiding according to the research in this post.
Jarrow Formulas Jarro-Dophilus® AF Allergen-Free is an inexpensive option (does contain L. Acidophilus)

Specific products that seem to match my own family's needs:

Kirkman CD Biotic
Kirkman Bifido Complex
Kirkman Lactobacillus Duo™ - Hypoallergenic
(contains Lactobacillus rhamnosus, Lactobacillus plantarum)Thorne Bacillus Coagulans
Pure Encapsulations Lactobacillus Sporogenes (contains rice starch)
Seeking Health Probiota Bifido
Seeking Health Bacillus Coagulans
Seeking Health ProBiota Infant Probiotic Powder (except that it contains L. Casei)
Culturelle dairy and gluten free formula (does contain prebiotics)

Possibly good:
Thorne FloraMend Prime Probiotic (pending research of L. Gasseri)
Jarrow Formulas Ideal Bowel Support 299v (does contain a trace of soy)
Natren Bifido Factor Dairy Free (contains potato and chickpea)

If you're not avoiding acidophilus:
Pharmax HLC Maintenance Probiotic Supplement

Gastrointestinal Health

The use of bacterial spore formers as probiotics.

"Among the large number of probiotic products in use today are bacterial spore formers, mostly of the genus Bacillus. Used primarily in their spore form, these products have been shown to prevent gastrointestinal disorders... Specific mechanisms for how Bacillus species can inhibit gastrointestinal infections will be covered, including immunomodulation and the synthesis of antimicrobials."

Review article: probiotics and prebiotics in irritable bowel syndrome
"A range of probiotics including VSL#3 and L. plantarum 299v enhance (intestinal) barrier function.

Many probiotics including Lactobacillus spp. ferment unabsorbed polysaccharides to generate SCFAs including lactic acid. This acidifies the colonic contents; this acidification inhibits some bacteria and allows others to flourish. Thus 2 × 1010 L. plantarum 299v daily in humans increased acetic, proprionic and butyric acid concentration, while increasing the number of faecal Bifidobacteria spp. and Lactobacillus spp. and reducing the numbers of Clostridia spp.

(S)tress-induced increase in gut permeability and associated visceral hypersensitivity can be inhibited by the probiotic L. paracasei and its soluble products.

Two probiotics, Lactobacillus farciminis, a nitric oxide producing probiotics and L. paracasei NCC2461, have been shown to reduce the increased colonic permeability induced by both partial restraint stress and maternal deprivation (in rats).

(A)dministration of L. rhamnosus to healthy volunteers increased IL-10 secretion and decreased TNF, IL-6 and interferon secretion by peripheral blood mononuclear cells (PBMCs). A similar effect was seen with L. rhamnosus GG, which increases serum IL-10 in atopic children. The probiotic mixture VSL#3 (mixture of .6 × 1010 Lactobacillus spp. (casei, plantarum, acidophilus, delbrueckii ssp. bulgaricus) together with Bifidobacterium (longum,breve and infantis) and one strain of Streptococcus salivarius ssp. thermophilus), which is known to exert an anti-inflammatory effect in pouchitis has also been shown to increase FoxP3 mRNA, a marker of Treg cells.

One relevant study using the Trichinella spiralis mouse model of postinfectious IBS showed that the inhibition of small intestinal contractions seen postinfection was reversed by treatment with L. paracasei, both live and using culture media supernatant. A proteomic analysis showed that supernatant treatment normalized a number of proteins related to cytoskeletal organization and stress response and also reduced a number of markers of inflammation.

E. coli Nissle 1917 has been shown to inhibit the visceral hypersensitivity associated with trinitrobenzene sulphonic acid (TNBS) colitis and L. paracasei inhibits the visceral hypersensitivity associated with inflammation in healthy mice in whom the bacterial microbiota have been disturbed by antibiotics.

An entirely novel mode of action of probiotics has recently been demonstrated in which L. acidophilus increased the expression of μ-opioid and cannabinoid receptors in normal animals, a phenomenon which was associated with an inhibition of visceral sensitivity equivalent to that of morphine 0.1 mg/kg. This action appears independent of an anti-inflammatory effect.

Along with colonization of the gut, L. plantarum significantly decreased the number of sulphite-reducing Clostridia spp. within a week of starting intake.

Treatment with B. infantis was shown to cause a significant reduction in a composite IBS score which included abdominal pain and bloating and difficulties with bowel movements. This was also associated with a change in PBMC cytokine production as assessed by the ratio of IL-10 to IL-12."
Lactobacillus reuteri accelerates gastric emptying and improves regurgitation in infants.

"In infants with functional GER, L. reuteri DSM 17938 reduce gastric distension and accelerate gastric emptying. In addition, this probiotic strain seems to diminish the frequency of regurgitation."

Effect of Bacillus subtilis PB6, a natural probiotic on colon mucosal inflammation and plasma cytokines levels ininflammatory bowel disease.
"The pathophysiology of inflammatory bowel disease (IBD) involves the production of diverse lipid mediators, namely eicosanoid, lysophospholipids, and platelet-activating factor, in which phospholipase A2 (PLA2) is the key enzyme. Thus, it has been postulated that control of lipid mediators production by inhibition of PLA2 would be useful for the treatment of IBD. This hypothesis has been tested in the present study by examining the therapeutic effect of a novel natural probitic Bacillus subtilis PB6 (ATCC- PTA 6737). B. subtilis PB6 is found to secrete surfactins (cyclic lipopeptides) which have anti-bacterial potential. These surfactins inhibit PLA2, a rate-limiting enzyme involved in the arachidonic acid associated inflammatory pathway and could downregulate the inflammatory response by regulating the eicosanoid and cytokine pathways. With this concept, an experimental animal trial has been conducted in a rat model of 2, 4, 6-trinitrobenzene sulfonic acid (TNBS)-induced colitis. The oral administration of PB6 suppresses the colitis as measured by mortality rate, changes in the weight gain, colon morphology and the levels of plasma cytokines. The animals treated orally with PB6 at 1.5 x 10(8) CFU/kg thrice daily from day 4 to 10 significantly improve gross pathology of the colon and regain the colonweight to normal (p < 0.05), compared to TNBS-induced positive control. The plasma levels of pro-inflammatory cytokines (TNF-alpha, 1L-1beta, IL-6 and IFN-gamma) are also significantly lowered (p < 0.05) and anti-inflammatory cytokine (IL-I0 and TGF-beta) significantly (p < 0.05) increased after the oral administration of PB6 on day 11. The present study supports the concept that PB6 inhibits PLA2 by the secreting surfactins. In a clinical investigation, it is found to be well tolerated by all the healthy volunteers."

This is an article with more information about B.Subtilis and it's role in human health.  Sources of this probiotc include MegaSporeBiotic, PeakBiotic, and NST Probiotics.

Immune Modulation

"in the subset of forty-four randomized subjects providing biological samples, we showed that consumption of B. subtilis CU1 significantly increased fecal and salivary secretory IgA concentrations compared to the placebo. A post-hoc analysis on this subset showed a decreased frequency of respiratory infections in the probiotc group compared to the placebo group. Taken together, our study provides evidence that B. subtilis CU1 supplementation during the winter period may be a safe effective way to stimulate immune responses in elderly subjects."

Allergy and Mast Cell Response

Specific probiotics alleviate allergic rhinitis during the birch pollen season

"Birch pollen allergy was shown to be associated with changes in fecal microbiota composition. The specific combination of probiotics used (Lactobacillus acidophilus and Bifidobacterium lactis) was shown to prevent the pollen-induced infiltration of eosinophils into the nasal mucosa, and indicated a trend for reduced nasal symptoms."


"Human peripheral-blood-derived mast cells were stimulated with Lactobacillus rhamnosus (L. rhamnosus) GG (LGG(®)), L. rhamnosus Lc705 (Lc705), Propionibacterium freudenreichii ssp. shermanii JS (PJS) and Bifidobacterium animalis ssp. lactis Bb12 (Bb12) and their combination.

LGG and Lc705 were observed to suppress genes that encoded allergy-related high-affinity IgE receptor subunits α and γ (FCER1A and FCER1G, respectively) and histamine H4 receptor. LGG, Lc705 and the combination of four probiotics had the strongest effect on the expression of genes involved in mast cell immune system regulation, and on several genes that encoded proteins with a pro-inflammatory impact, such as interleukin (IL)-8 and tumour necrosis factor alpha. Also genes that encoded proteins with anti-inflammatory functions, such as IL-10, were upregulated.

CONCLUSION: Certain probiotic bacteria might diminish mast cell allergy-related activation by downregulation of the expression of high-affinity IgE and histamine receptor genes, and by inducing a pro-inflammatory response."

Immunomodulatory effects of potential probiotics in a mouse peanut sensitization model

"Prophylactic treatment with both HMI001 ( L. Salivarius) and LCS ( L. casei Shirota) attenuated the Th2 phenotype (reduced mast cell responses and ex vivo IL-4 and/or IL-5 production).

In contrast, WCFS1 ( L. Plantarum) augmented the Th2 phenotype (increased mast cell and antibody responses and ex vivo IL-4 production).

In vitro PBMC screening was useful in selecting strains with anti-inflammatory and Th1 skewing properties. In case of HMI001 (high IL-10/IL-12 ratio) and LCS (high interferon-γ and IL-12), partial protection was seen in a mouse peanut allergy model. Strikingly, certain strains may worsen the allergic reaction as shown in the case of WCFS1."

Effect of a New Synbiotic Mixture on Atopic Dermatitis in Children: a Randomized-Controlled Trial

"This study provides evidence that a mixture of seven strains of probiotics and Fructooligosaccharide can clinically improve the severity of AD in young children. Further studies are needed to investigate the effects on underlying immune responses and the potential long term benefits for patients with AD.

In a randomized, double-blind, placebo-controlled trial, we aimed on studying the clinical and immunologic effects of a mixture of seven strains of probiotic bacteria (Lactobacillus casei, Lactobacillus rhamnosus, Streptococcus thermophilus, Bifidobacterium breve, Lactobacillus acidophilus, Bifidobacterium infantis, Lactobacillus bulgaricus) and Fructooligosaccharide in the treatment of AD in infancy and early childhood."

Screening selected strains of probiotic lactic acid bacteria for their ability to produce biogenic amines (histamine and tyramine)

"The aim of this study was to investigate the production of biogenic amines (BA), histamine and tyramine by some probiotic lactic acid bacteria (LAB). Fifteen strains representing six LAB species were screened qualitatively by growing them in a decarboxylase medium. Lactobacillus casei (TISTR 389) and Lactobacillus delbrueckii subsp. bulgaricus (TISTR 895) were found to produce BA. The highest levels of histamine (1820.9 ± 3.5 mg L−1) and tyramine (5486.99 ± 47.6 mg L−1) formation were observed for the TISTR 389 strain, while TISTR 895 produced only histamine (459.1 ± 0.63 mg L−1) in the decarboxylase broth. Biogenic amine potential was not observed for the Lactobacillus acidophilus, Lactobacillus lactis subsp. lactis,Lactococcus lactis subsp. lactis, and Lactobacillus plantarum strains studied. This study confirmed that BA formation is strain dependent and not related to the species. "

Psychological Health

'Psychobiotic' May Help Ease Stress, Improve Memory

"Taking a probiotic strain of Bifidobacterium longum reduced physiologic and psychological stress and led to a modest improvement in memory in a small pilot study of healthy men.

In response to acute stress, B longum NCIMB 41676 led to a reduction in cumulative output of the stress hormone cortisol, as well as a blunted increase in subjective anxiety. On the questionnaire, the men reported being less stressed and anxious while taking the probiotic. They also showed subtle improvement on a visual memory task after receiving the probiotic, as well as altered EEG output.

"This study represents a proof of principle," Dr Clarke said. "The question we are asking now is, can we advance this further and can we use these psychobiotics to deal with the stressors that we encounter on the roller coaster of life, or develop further psychobiotics for patients with stress-related disorders such as depression or anxiety."

Assessment of psychotropic-like properties of a probiotic formulation (Lactobacillus helveticus R0052 and Bifidobacterium longum R0175) in rats and human subjects.

"In a previous clinical study, a probiotic formulation (PF) consisting of Lactobacillus helveticus R0052 and Bifidobacterium longum R0175 (PF) decreased stress-induced gastrointestinal discomfort. Emerging evidence of a role for gut microbiota on central nervous system functions therefore suggests that oral intake of probiotics may have beneficial consequences on mood and psychological distress. The aim of the present study was to investigate the anxiolytic-like activity of PF in rats, and its possible effects on anxiety, depression, stress and coping strategies in healthy human volunteers... Daily subchronic administration of PF significantly reduced anxiety-like behaviour in rats (P < 0·05) and alleviated psychological distress in volunteers, as measured particularly by the HSCL-90 scale (global severity index, P < 0·05; somatisation, P < 0·05; depression, P < 0·05; and anger-hostility, P < 0·05), the HADS (HADS global score, P < 0·05; and HADS-anxiety, P < 0·06), and by the CCL (problem solving, P < 0·05) and the UFC level (P < 0·05). L. helveticus R0052 and B. longum R0175 taken in combination display anxiolytic-like activity in rats and beneficial psychological effects in healthy human volunteers."