This blog is a way of sharing the information and resources that have helped me to recover my son Roo from an Autism Spectrum Disorder. What I have learned is to view our symptoms as the results of underlying biological cause, which can be identified and healed. I say "our symptoms" because I also have a neuro-immune disorder called Myalgic Encephalomyelitis.

And, of course, I am not a doctor (although I have been known to impersonate one while doing imaginative play with my son)- this is just our story and information that has been helpful or interesting to us. I hope it is helpful and interesting to you!


Showing posts with label Epigenetics. Show all posts
Showing posts with label Epigenetics. Show all posts

Friday, October 28, 2016

Connections Between MCAS, EDS, Dysautonomia/POTS, and other Conditions

In this commentary piece by Dr Stephen Genuis MD, Pandemic of idiopathic multi-morbidity, he makes the argument that there is a relatively sudden increase in certain types of diseases, particularly allergic diseases.  He calls this condition "multi-morbidity" which simply refers to a patient with 2 or more chronic diseases or complaints.  He argues- as many have regarding autism- that a sudden and dramatic increase in a medical condition is not well explained by claiming that the condition is genetic, as genes don't change that quickly.  A sudden and dramatic increase in a disease implies an environmental influence.  He has noticed, as many others have, that some symptoms and diseases often appear together including headache, joint pain, fatigue, brain fog, bloating, chemical intolerance, muscle aches, itchy skin, abdominal discomfort, and fibromyalgia.

Dr Genuis confirms what many of us living with these symptoms already know- that many, if not most doctors do not believe that this constellation of symptoms is caused by physiological illness, but rather is a psychiatric somatic illness requiring anti-depressants for therapy.  In his attempts to uncover a common physiological explanation, he says "A foray into the recesses of the scientific literature reveals discussion of a condition called sensitivity-related illness (SRI), with description of a credible causal mechanism to account for much of the emerging pandemic of multisystem health problems. This condition results when toxicant accrual within the human organism— typically from exposure to adverse chemicals—induces a state of immune dysregulation and hypersensitivity resulting in physiological disruption within various organ systems. The pathogenesis relates to an intriguing phenomenon called toxicant-induced loss of tolerance, a finding that represents a considerable advance in medical science pertaining to the origins and mechanisms of disease."

It seems that more and more doctors and researchers have begun paying attention to the co-morbidity of diseases and symptoms such as Mast Cell Disease (MCAD), Eosinophilic diseases (EGIDs and HES), other digestive disorders and symptoms, allergy and other forms of atopy such as eczema, migraines and other headaches, Ehlers-Danlos Syndrome (EDS) and other joint and connective tissue symptoms and disorders, psychiatric symptoms such as ADHD, OCD, panic disorders, and anxiety, neurological and neurodevelopmental disorders including autism and seizures, as well as many others.  In particular, the three disorders of EDS, MCAS, and Dysautonomia (usually POTS) occur together so often that they are sometimes referred to as "the trifecta".

Unifying Theories:
Researchers identify new spectrum disorder called ALPIM syndrome
"Panic disorder itself may be a predictor for a number of physical conditions previously considered unrelated to mental conditions, and for which there may be no or few biological markers," explains Dr. Coplan.  In the study, published in the Journal of Neuropsychiatry and Clinical Neurosciences, the researchers proposed the existence of a spectrum syndrome comprising a core anxiety disorder and four related domains, for which they have coined the term ALPIM."  These are: A = Anxiety disorder (mostly panic disorder); L = Ligamentous laxity (joint hypermobility syndrome, scoliosis, double-jointedness, mitral valve prolapse, easy bruising); P = Pain (fibromyalgia, migraine and chronic daily headache, irritable bowel syndrome, prostatitis/cystitis); I = Immune disorders (hypothyroidism, asthma, nasal allergies, chronic fatigue syndrome); and M = Mood disorders (major depression, Bipolar II and Bipolar III disorder, tachyphylaxis. Two thirds of patients in the study with mood disorder had diagnosable bipolar disorder and most of those patients had lost response to antidepressants).

Dr Meglathery, herself a patient with this combination of diagnoses, has developed a theory called The RCCX Theory that argues for an underlying genetic connection between these conditions.
Dr Diana Driscoll has developed a theory she calls The Driscoll Theory that connects POTS, MCAS and EDS, and ties in some of the other symptoms/issues as well (including cranial hypertension).  She also has a number of videos on her site that explain the connections in more detail.

The blogger over at Oh Twist describes in a post called The Chronic Constellation the list of disorders that so many of us as patients have noticed.  She also includes mitochondrial diseases, autism spectrum disorders, and many autoimmune diseases in this cluster of disorders.

Scientific Papers Documenting Connections and Comorbidities:
MCAS (a common underlying cause of ME/CFS), Allergy, and Atopic Diseases
A New Disease Cluster: Mast Cell Activation Syndrome, Postural Orthostatic Tachycardia Syndrome, and Ehlers-Danlos Syndrome
"15 participants completed questionnaires with required documentation. All eligible participants were female. 12 of these people had formal diagnoses of POTS (80%), 9 were diagnosed with both POTS and EDS. 6 of 9 patients with both POTS and EDS had validated symptoms of a mast cell disorder (66%), suggestive of MCAS."
 
The Suggested Relationships Between Common GI Symptoms and Joint Hypermobility, POTS, and MCAS
“An increasing number of reports suggest an association between a newly recognized disease cluster and significant and often disabling gastrointestinal (GI) symptoms. This cluster is composed of diagnoses of hypermobility spectrum disorders (HSDs) such as joint hypermobility and hypermobile variant Ehlers-Danlos syndrome (hEDS), postural orthostatic tachycardia syndrome (POTS), and mast cell activation syndrome (MCAS)... This article describes a cohort of young adult females who shared similar GI symptoms, with intractable nausea and vomiting being most prominent and gastroesophageal reflux disease and constipation also occurring. Most strikingly, these females also exhibited or reported a history of HSD, hEDS, POTS, and/or MCAS. The clinical course of their GI symptoms was remarkable for considerable challenges in management, and artificial nutritional support proved necessary for some. This article describes the clinical features and outcomes of their GI manifestations, examines how these manifestations might be linked to their systemic syndromes, and discusses whether a shared pathophysiology exists..”

Association of mast-cell-related conditions with hypermobile syndromes: a review of the literature
"Aberrant mast cell activation has been shown to play a role in disruption of connective tissue integrity through activity of its mediators including histamine and tryptase which affects multiple organ systems resulting in mast cell activation disorders (MCAD). The overlap of findings associated with MCAD and the immune-mediated and rheumatologic conditions in patients with hEDS/HSD may provide an explanation for the relationship among these conditions and the presence of chronic inflammatory processes in these patients. It is clear that a multidisciplinary approach is required for the treatment of patients with EDS. However, it is also important for clinicians to consider the summarized symptoms and MCAD-associated characteristics in patients with multiple complaints as possible manifestations of connective tissue disorders, in order to potentially aid in establishing an early diagnosis of EDS."
 
 
 
Dysautonomia, Hypermobility Spectrum Disorders and Mast Cell Activation Syndrome as Migraine Comorbidities 
“Numerous studies indicate a significant overlap and shared pathophysiology in migraine, dysautonomia, HSD, and MCAS. In clinical setting, dysautonomia, HSD, and MCAS may present a diagnostic and therapeutic challenge in patients with migraine and require a high index of suspicion on the part of the neurologist. Diagnosis and treatment of these complex disorders in patients with migraine is essential to comprehensive patient-centric care, reduced symptom burden, and improved functional impairment secondary to both migraine and comorbidities.”

 
 
 
 
 
Psychiatric disorders and symptoms severity in preschool children with cow's milk allergy.

Association of atopic diseases and attention-deficit/hyperactivity disorder: A systematic review and meta-analyses.
 
 
[Severe Mast Cell Activation Syndrome in a 15-year-old patient with an hypermobile Ehlers-Danlos syndrome]
"We report the history of a 15-year old patient with a hypermobile Ehlers-Danlos syndrome (hEDS)...  We describe the MCAS and its easy, fast and very effective medication management, without any significant side effects as well as its frequent association with the hEDS. We finally introduce the original term of «MASED» to this MCAS, associated, linked or entangled to hEDS."  

Mast cell activation disease and immunoglobulin deficiency in patients with hypermobile Ehlers-Danlos syndrome/hypermobility spectrum disorder
"The presence of MCAD and Ig Def should be explored in patients with hEDS/HSD. Identifying underlying contributors to recurrent/chronic inflammation and tissue injury is needed to tailor and personalize therapies. This, in turn, can reduce tissue damage, iatrogenic intervention, and optimize health outcomes."
 
EDS (Ehlers-Danlos Syndrome) and Other Connective Tissue Disorders
 
 
Some cases of hypermobile Ehlers-Danlos syndrome may be rooted in mast cell activation syndrome
"Although hEDS is seen in only a minority of MCAS cases, limited studies have identified an association between hEDS and MCAS, fueling speculation that certain variants of MCAS may drive hEDS. No laboratory studies probing cellular or molecular linkages between hEDS and MCAS have been conducted yet, and research efforts to identify the genetic roots of hEDS should also consider those of MCAS." 

Decoding the Genetic Basis of Mast Cell Hypersensitivity and Infection Risk in Hypermobile Ehlers-Danlos Syndrome
"Recent studies have linked hEDS with mast cell activation syndrome (MCAS), suggesting a genetic interplay affecting immune regulation and infection susceptibility. This study aims to decode the genetic basis of mast cell hypersensitivity and increased infection risk in hEDS by identifying specific genetic variants associated with these conditions."
 
A new insight on postural tachycardia syndrome in 102 adults with hypermobile Ehlers-Danlos Syndrome/hypermobility spectrum disorder
“This study confirms the high rate and heterogeneity of abnormal autonomic regulation in hEDS/HSD, and suggests the baroreflex sensitivity might distinguish comorbid POTS from other profiles in this subgroup of patients. Abnormal autonomic regulation is common in adults with hEDS/HSD and should be regularly assessed for tailoring the management approach.”
 
 
Hypermobile Ehlers-Danlos syndrome and disorders of the gastrointestinal tract: What the gastroenterologist needs to know
"Hypermobile Ehlers-Danlos syndrome (hEDS) and the hypermobility spectrum disorders (HSD) can be challenging to diagnose and manage. Gastrointestinal symptoms and disorders of gut-brain interaction are common in this cohort and multifactorial in origin. The primary aim of this review is to arm the gastroenterologist with a clinically useful understanding of HSD/hEDS, by exploring the association of gastrointestinal disorders with HSD/hEDS, highlighting current pathophysiological understanding and providing a pragmatic approach to managing these patients."
 
 
Sleep research in autism and connective tissue

Joint hypermobility is more common in children with chronic fatigue syndrome than in healthy controls.

[Fibromyalgia: an unrecognized Ehlers-Danlos syndrome hypermobile type?].

High prevalence of eosinophilic esophagitis in patients with inherited connective tissue disorders

Eosinophilic gastrointestinal disorders associated with autoimmune connective tissue disease.

Dysautonomia and POTS (Postural Orthostatic Tachycardia Syndrome)
Gastrointestinal symptoms associated with orthostatic intolerance.

Symptom overlap and comorbidity of irritable bowel syndrome with other conditions.

Characterizing Gulf War Illnesses: neurally mediated hypotension and postural tachycardia syndrome.

Neurally mediated hypotension and chronic fatigue syndrome.

Eosinophilic and Other GI Disorders
Psychological Functioning of Children and Adolescents With Eosinophil-Associated Gastrointestinal Disorders

Miscellaneous
New study shows severity of tinnitus (ringing in the ears) is related to emotional processing


Thursday, April 7, 2016

Many Factors Influence the Individual Response to Vaccination

Variation in vaccine response in normal populations.
Pharmacogenomics. 2004 Jun;5(4):417-27.
"Genetic polymorphisms of the human leukocyte antigen (HLA) system significantly influence the variation in immune responses to viral vaccines. Considerable data on the genetic determinants of immune responses to the measles vaccine support the importance of HLA genes in determining the variation in vaccine response. HLA class I and class II, TAP, and HLA-DM allele associations with measles-specific antibody levels following measles vaccination have revealed, in part, the immunologic basis for mechanisms of measles immunity variation. Associations between HLA genotype and immune responses have also been reported for other vaccines and infectious diseases, such as hepatitis B and C, human papillomaviruses, and influenza. Vaccine pharmacogenomics may provide important insights for the design and development of new peptide-based vaccines against measles and other pathogens."

The link between genetic variation and variability in vaccine responses: systematic review and meta-analyses.
Vaccine. 2014 Mar 26;32(15):1661-9
"Although immune response to vaccines can be influenced by several parameters, human genetic variations are thought to strongly influence the variability in vaccine responsiveness. Systematic reviews and meta-analyses are needed to clarify the genetic contribution to this variability, which may affect the efficacy of existing vaccines. We performed a systematic literature search to identify all studies describing the associations of allelic variants or single nucleotide polymorphisms in immune response genes with vaccine responses until July 2013. The studies fulfilling inclusion criteria were meta-analyzed. Thirteen studies (11,686 subjects) evaluated the associations of human leukocyte antigen (HLA) and other immunity gene variations with the responses to single vaccines, including MMR-II (measles and rubella virus), HepB (hepatitis virus), influenza virus, and MenC (serogroup C meningococcus) vaccines. Seven HLA genetic variants were included in the meta-analyses... (W)hile our findings reinforce the concept that individuals with a particular HLA allelic composition are more likely to respond efficiently to vaccines, future studies should be encouraged to further elucidate the link between genetic variation and variability of the human immune response to vaccines."

"Vaccinations have been used as an essential tool in the fight against infectious diseases, and succeeded in improving public health. However, adverse effects, including autoimmune conditions may occur following vaccinations (autoimmune/inflammatory syndrome induced by adjuvants--ASIA syndrome). It has been postulated that autoimmunity could be triggered or enhanced by the vaccine immunogen contents, as well as by adjuvants, which are used to increase the immune reaction to the immunogen. Fortunately, vaccination-related ASIA is uncommon. Yet, by defining individuals at risk we may further limit the number of individuals developing post-vaccination ASIA. In this perspective we defined four groups of individuals who might be susceptible to develop vaccination-induced ASIA: patients with prior post-vaccination autoimmune phenomena, patients with a medical history of autoimmunity, patients with a history of allergic reactions, and individuals who are prone to develop autoimmunity (having a family history of autoimmune diseases; asymptomatic carriers of autoantibodies; carrying certain genetic profiles, etc.)."


Pediatr Infect Dis J. May 2009; 28(5): 431–432.
"With current and future technologic advances such as high throughput whole-genome scanning, transcriptomics, epigenetics, proteomics, and new biostatistical approaches to understanding huge databases of information, we can better understand associations and mechanisms by which genetically-mediated individual variations in vaccine response and reactivity occur. Armed with such knowledge, the ability to predict such AEs (adverse events), or to design new vaccine approaches that minimize or eliminate serious vaccine-related reactions could be devised, consistent with a more personalized or individual approach to vaccine practice which we have called adversomics (the immunogenetics and immunogenomics of vaccine adverse events at the individual and population level, respectively)...

We believe that adversomics (the immunogenetics and immunogenomics of vaccine adverse events at the individual and population level, respectively) is critical to understanding and preventing serious adverse vaccine-related events, developing the next generation of vaccines, and to improving public confidence in vaccine safety."


Vaccine immunogenetics: bedside to bench to population.
Vaccine. 2008 Nov 18;26(49):6183-8.
"The immunogenetic basis for variations in immune response to vaccines in humans remains largely unknown. Many factors can contribute to the heterogeneity of vaccine-induced immune responses, including polymorphisms of immune response genes. It is important to identify those genes involved directly or indirectly in the generation of the immune response to vaccines. Our previous work with measles reveals the impact of immune response gene polymorphisms on measles vaccine-induced humoral and cellular immune responses. We demonstrate associations between genetic variations (single nucleotide polymorphisms, SNPs) in HLA class I and class II genes, cytokine, cell surface receptor, and toll-like receptor genes and variations in immune responses to measles vaccine. Such information may provide further understanding of genetic restrictions that influence the generation of protective immune responses to vaccines, and eventually the development of new vaccines."

Heterogeneity in vaccine immune response: the role of immunogenetics and the emerging field of vaccinomics.
Clin Pharmacol Ther. 2007 Dec;82(6):653-64.
"Recent advances in the fields of immunology, genetics, molecular biology, bioinformatics, and the Human Genome Project have allowed for the emergence of the field of vaccinomics. Vaccinomics encompasses the fields of immunogenetics and immunogenomics as applied to understanding the mechanisms of heterogeneity in immune responses to vaccines. In this study, we examine the role of HLA genes, cytokine genes, and cell surface receptor genes as examples of how genetic polymorphism leads to individual and population variations in immune responses to vaccines. In turn, this data, in concert with new high-throughput technology, inform the immune-response network theory to vaccine response. Such information can be used in the directed and rational development of new vaccines, and this new golden age of vaccinology has been termed "predictive vaccinology", which will predict the likelihood of a vaccine response or an adverse response to a vaccine, the number of doses needed and even whether a vaccine is likely to be of benefit (i.e., is the individual at risk for the outcome for which the vaccine is being administered?)."

Variability in Humoral Immunity to Measles Vaccine: New Developments.
Trends Mol Med. 2015 Dec;21(12):789-801
"Despite the existence of an effective measles vaccine, resurgence in measles cases in the USA and across Europe has occurred, including in individuals vaccinated with two doses of the vaccine. Host genetic factors result in inter-individual variation in measles vaccine-induced antibodies, and play a role in vaccine failure. Studies have identified HLA (human leukocyte antigen) and non-HLA genetic influences that individually or jointly contribute to the observed variability in the humoral response to vaccination among healthy individuals. In this exciting era, new high-dimensional approaches and techniques including vaccinomics, systems biology, GWAS, epitope prediction and sophisticated bioinformatics/statistical algorithms provide powerful tools to investigate immune response mechanisms to the measles vaccine. These might predict, on an individual basis, outcomes of acquired immunity post measles vaccination."

The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches.
Expert Rev Vaccines. 2013 Jan;12(1):57-70.
"The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of 'vaccinomics' for novel vaccine development."

Hum Immunol. 2010 Apr;71(4):383-91
"Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine."

SNP/haplotype associations in cytokine and cytokine receptor genes and immunity to rubella vaccine.
Immunogenetics. 2010 Apr;62(4):197-210
"An effective immune response to vaccination is, in part, a complex interaction of alleles of multiple genes regulating cytokine networks. We conducted a genotyping study of Th1/Th2/inflammatory cytokines/cytokine receptors in healthy children (n = 738, 11-19 years) to determine associations between individual single-nucleotide polymorphisms (SNPs)/haplotypes and immune outcomes after two doses of rubella vaccine. SNPs (n = 501) were selected using the ldSelect-approach and genotyped using Illumina GoldenGate and TaqMan assays. Rubella-IgG levels were measured by immunoassay and secreted cytokines by ELISA. Linear regression and post hoc haplotype analyses were used to determine associations between single SNPs/haplotypes and immune outcomes. Increased carriage of minor alleles for the promoter SNPs (rs2844482 and rs2857708) of the TNFA gene were associated with dose-related increases in rubella antibodies. IL-6 secretion was co-directionally associated (p < or = 0.01) with five intronic SNPs in the TNFRSF1B gene in an allele dose-related manner, while five promoter/intronic SNPs in the IL12B gene were associated with variations in IL-6 secretion. TNFA haplotype AAACGGGGC (t-statistic = 3.32) and IL12B promoter haplotype TAG (t-statistic = 2.66) were associated with higher levels of (p < or = 0.01) rubella-IgG and IL-6 secretion, respectively. We identified individual SNPs/haplotypes in TNFA/TNFRSF1B and IL12B genes that appear to modulate immunity to rubella vaccination. Identification of such "genetic fingerprints" may predict the outcome of vaccine response and inform new vaccine strategies."

Rubella vaccine-induced cellular immunity: evidence of associations with polymorphisms in the Toll-like, vitamin A and D receptors, and innate immune response genes.
Hum Genet. 2010 Feb;127(2):207-21
"Toll-like, vitamin A and D receptors and other innate proteins participate in various immune functions. We determined whether innate gene-sequence variations are associated with rubella vaccine-induced cytokine immune responses. We genotyped 714 healthy children (11-19 years of age) after two doses of rubella-containing vaccine for 148 candidate SNP markers. Rubella virus-induced cytokines were measured by ELISA. Twenty-two significant associations (range of P values 0.002-0.048) were found between SNPs in the vitamin A receptor family (RARA, RARB, TOP2B and RARG), vitamin D receptor and downstream mediator of vitamin D signaling (RXRA) genes and rubella virus-specific (IFN-gamma, IL-2, IL-10, TNF-alpha, and GM-CSF) cytokine immune responses. A TLR3 gene promoter region SNP (rs5743305, -8441A > T) was associated with rubella-specific GM-CSF secretion. Importantly, SNPs in the TRIM5 gene coding regions, rs3740996 (His43Tyr) and rs10838525 (Gln136Arg), were associated with an allele dose-related secretion of rubella virus-specific TNF-alpha and IL-2/GM-CSF, respectively, and have been previously shown to have functional consequences regarding the antiviral activity and susceptibility to HIV-1 infection. We identified associations between individual SNPs and haplotypes in, or involving, the RIG-I (DDX58) gene and rubella-specific TNF-alpha secretion. This is the first paper to present evidence that polymorphisms in the TLR, vitamin A, vitamin D receptor, and innate immunity genes can influence adaptive cytokine responses to rubella vaccination."

"In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans."

The genetic basis for measles vaccine failure.
Acta Paediatr Suppl. 2004 May;93(445):43-6; discussion 46-7.
"The US measles epidemics of 1989-1991 included a series of outbreaks resulting from vaccine failure. A series of studies was launched aimed at elucidating the mechanisms of this vaccine failure. A meta-analysis of the literature examining epidemics in vaccinated populations was conducted, which showed that the secondary vaccine failure rate (development of the disease despite an initial or primary vaccine success) is no more than 0.2%. The overwhelming proportion of measles vaccine failure was due to primary vaccine failure (failure to ever generate antibody from antigenic stimulation). This comparison of two geographically distinct communities revealed that 10% of children previously vaccinated against measles lacked antibody on follow-up and that these vaccine failures clustered in families. A study of monozygotic and dizygotic twins revealed a high degree of heritability of measles vaccine antibody level. Subsequent studies found associations with both class I and class II alleles in these population-based studies. In the future, detection of the specific peptides that interact with human leukocyte antigen (HLA) molecules may serve as the basis for improved vaccines and address vaccine failure that results from cold-chain problems, immaturity of the immune system, malnutrition and maternal immunity."

"Febrile seizures represent a serious adverse event following measles, mumps and rubella (MMR) vaccination. We conducted a series of genome-wide association scans comparing children with MMR-related febrile seizures, children with febrile seizures unrelated to vaccination and controls with no history of febrile seizures. Two loci were distinctly associated with MMR-related febrile seizures, harboring the interferon-stimulated gene IFI44L (rs273259: P = 5.9 × 10−12 versus controls, P = 1.2 × 10−9 versus MMR-unrelated febrile seizures) and the measles virus receptorCD46 (rs1318653: P = 9.6 × 10−11 versus controls, P = 1.6 × 10−9 versus MMR-unrelated febrile seizures)."

Effects of vitamin A and D receptor gene polymorphisms/haplotypes on immune responses to measles vaccine.
Pharmacogenet Genomics. 2012 Jan;22(1):20-31
"Our results suggest that specific allelic variations and haplotypes in the vitamin A receptor and VDR genes may influence adaptive immune responses to measles vaccine."
Vaccine. 2011 Oct 19;29(45):7883-95
"Identification of host genetic determinants of measles vaccine-induced immunity can be used to design better vaccines and ultimately predict immune responses to vaccination. We performed a comprehensive candidate gene association study across 801 genetic markers in 56 cytokine/cytokine receptor genes, in a racially diverse cohort of 745 schoolchildren after two doses of MMR vaccine. Using linear regression methodologies we examined associations between SNPs/haplotypes and measles virus-specific immunity. Forty-eight significant SNP associations with variations in neutralizing antibodies and measles-specific IFNγ Elispot responses were identified (p<0 .05="" a="" african-americans.="" an="" analysis="" and="" associated="" association="" associations="" but="" caucasian="" caucasians="" cellular="" confirmed="" demonstrated="" determinants="" elispot="" findings="" found="" functional="" genetic="" global="" group="" haplotype="" hr244ile="" humoral="" i="" identify="" il10="" il12b="" il2="" il7r="" immune="" immunity="" important="" in="" including="" level="" manner.="" measles-specific="" measles="" multiple="" new="" non-synonymous="" not="" of="" or="" our="" p-value="0.003)." p="" plausible="" polymorphisms="" previous="" previously="" promoter="" race-specific="" regulating="" replicated="" reported="" responses="" results="" rs1800890="" rs2069762="" rs3212227="" rs6897932="" similarly="" snp="" study="" the="" two="" vaccine-induced="" validate="" variant="" variants="" variations="" were="" with="">

Vaccine. 2004 May 7;22(15-16):1914-20.
"Associations between human leukocyte antigen (HLA) genes and very high levels of antibodies (or hyperseroresponsiveness) to measles antigens in a genetically heterogeneous human population are poorly understood. We studied the association between antibody levels after measles vaccination and HLA class I and II alleles among 170 US schoolchildren who received one dose of measles-mumps-rubella II vaccine. Vaccine recipients were divided into two groups: 93 recipients who were seropositive and 77 recipients who were hyperseropositive (the upper 10th percentile of antibody levels of all subjects). Out of all the alleles analyzed, HLA-B(*)7 (odds ratio (OR) 1.9; P = 0.05), DQA1(*)0104 (OR 4.6; P = 0.02) and DPA1(*)0202 (OR 4.8; P = 0.04) alleles were positively associated with hyperseropositivity, whereas HLA-B(*)44 (OR 0.4; P = 0.02), DRB1(*)01 (OR 0.6; P = 0.09), DRB1(*)08 (OR 0.3; P = 0.04), DQB1(*)0301 (OR 0.5; P = 0.04), and DPB1(*)0401 (OR 0.6; P = 0.03) alleles were negatively associated with hyperseropositivity. The alleles B(*)44, DRB1(*)01, DRB1(*)08 and DQA1(*)0104 remained statistically significant after accounting for the effects of other alleles. The results suggest that HLA alleles have important associations with measles antibody hyperseropositivity. These data increase our understanding of measles vaccine-induced immune response and will be useful for future mechanistic work on measles virus antigen processing and presentation in seronegative and hyperseropositive individuals."

Hum Hered. 2011;72(3):206-23.
"A previously detected association of the CD46 SNP rs2724384 with measles-specific antibodies was successfully replicated in this study. Increased representation of the minor allele G for an intronic CD46 SNP was associated with an allele dose-related decrease (978 vs. 522 mIU/ml, p = 0.0007) in antibody levels. This polymorphism rs2724384 also demonstrated associations with IL-6 (p = 0.02), IFN-α (p = 0.007) and TNF-α (p = 0.0007) responses. Two polymorphisms (coding rs164288 and intronic rs11265452) in the SLAM gene that were associated with measles antibody levels in our previous study were associated with IFN-γ Elispot (p = 0.04) and IL-10 responses (p = 0.0008), respectively, in this study. We found associations between haplotypes, AACGGAATGGAAAG (p = 0.009) and GGCCGAGAGGAGAG (p < 0.001), in the CD46 gene and TNF-α secretion.

Understanding the functional and mechanistic consequences of these genetic polymorphisms on immune response variations could assist in directing new measles and potentially other viral vaccine design, and in better understanding measles immunogenetics."

Hum Genet. 2011 Oct;130(4):547-61.
"Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines."

The association of class I HLA alleles and antibody levels after a single dose of measles vaccine.
Hum Immunol. 2003 Jan;64(1):103-9.
"Despite the success of the current measles vaccine in controlling disease in industrialized countries, the importance of vaccine failure has become increasingly apparent. Our objective was to determine if associations exist between seronegativity after measles vaccination and class I human leukocyte antigen (HLA) alleles. We undertook a cross-sectional observational study in Rochester, Minnesota, with 242 school-age children previously recruited from a communitywide seroprevalence study. We studied two groups of subjects: 72 were seronegative (EIA < or =0.8 after a single dose of measles vaccine) and 170 were seropositive (enzyme immunoassy [EIA] > or =1.0 after one dose). We used the resources of Mayo Clinic's tissue typing laboratory for serotyping class I HLA-A and HLA-B alleles via microlymphocytotoxicity assays. We found no statistically significant associations with class I HLA-A but did find associations with class I HLA-B, which includes alleles associated with seronegativity (B8, B13, and B44) and those associated with seropositivity (B7 and B51). Elucidation of the specific peptide-HLA complex interactions that lead to varying or failed immune responses may provide fertile groundwork for improved vaccines that can overcome limitations of the current live, attenuated measles vaccine."

The association between HLA class I alleles and measles vaccine-induced antibody response: evidence of a significant association.
Vaccine. 1998 Nov;16(19):1869-71.
"While the Moraten strain measles vaccine is an excellent, safe, and immunogenic vaccine, vaccine failure occurs, presumably when an individual develops an inadequate immune response. In this study, we examined the association of HLA class I genes and measles vaccine-induced antibody levels. We found that the allele distribution of HLA-B alleles differed between non-responders and hyper-responders (p = 0.002). Several class I alleles were associated with non-response (HLA-B13, -B44, and -C5); whereas several other alleles were associated with hyper-response (HLA-B7 and -B51). In addition, non-responders were more likely to be HLA-B homozygous than normal responders (odds ratio 2.1), and more likely to be homozygous than hyper-responders (odds ratio 3.7, p = 0.031 Mantel-Haenzel for trend). Finally, we found evidence of an allele dose-response phenomenon for HLA-B7. We conclude that there are important associations between class I HLA genes and measles antibody levels following immunization."

J Investig Med. 1996 Jun;44(5):261-3.
"The distribution of HLA-DRB1 alleles among nonresponders compared to hyper-responders was significantly different (p = 0.014). Nonresponders were significantly less likely to carry the HLA-DRB1*13 alleles than were hyper-responders (7.4% vs 16.2%;p = 0.02). Nonresponders also had an excess of HLA-DRB1*07 alleles (15.4% vs 6.2%; p = 0.015).

The absence of HLA-DRB1*13 alleles is associated with measles vaccine nonresponse. The absence of this allele has also been associated with susceptibility to other infectious diseases. The role of this gene in the immunogenetic response to infectious diseases requires further study."

Relationship of HLA-DQA1 alleles and humeral antibody following measles vaccination.
Int J Infect Dis. 1998 Jan-Mar;2(3):143-6.
"HLA-DQA1 alleles have important associations with the antibody response to measles vaccine. Specifically, the carriage of the HLA-DQA1*05 alleles is associated with nonresponse and that of HLA-DQA1*01 alleles with hyper response. In addition, HLA-DQA1 homozygosity is significantly associated with poor antibody response to measles vaccine."

Differential HLA gene expression in measles vaccine seropositive and seronegative subjects: a pilot study.
Scand J Infect Dis. 2003;35(5):332-6.
"This is the first study using GeneChip technology to elucidate genetic determinants of the measles vaccine response. A comparative gene expression study was conducted using Affymetrix's Human GeneChip U-95A in 5 human subjects immunized with a 'booster' dose of measles vaccine (Attenuax, Merck) to determine whether serologically distinct subjects exhibit differential expression of human leukocyte antigen (HLA) genes. Healthy individuals aged 15-25 y, previously immunized with 2 doses of measles-mumps-rubella-II (MMR-II) vaccine, were classified as measles vaccine immunoglobulin G-specific antibody seronegatives (n = 2) and seropositives (n = 3). Changes in expression of HLA genes in seronegatives and seropositives were studied on days 7 and 14 post-measles vaccination using Microarray Suite 5.0 (MAS 5.0). There was increased expression of the HLA class I-B (p = 0.0002), HLA class II cluster of DMA, DMB, TAP1, TAP2 (p = 0.0007) and HLA-DR (p = 0.0001) genes, and decreased expression of HLA class I MICB molecule (p = 1), HLA class I-A (p = 0.9999) and major histocompatibility complex class III HSP 70 (p = 0.9999) genes on day 7 or day 14 postvaccination in seropositives compared with seronegatives. These results suggest an association between antibody response and differential HLA gene activation and may explain one potential mechanism underlying measles vaccine non-response."

Polymorphisms of the TAP2 gene may influence antibody response to live measles vaccine virus.
Vaccine. 1997 Jan;15(1):3-6.
"These data reveal an association between TAP2 genotype and measles vaccine antibody response which may explain one mechanism behind vaccine failure."

Asthma status and waning of measles antibody concentrations after measles immunization.
Pediatr Infect Dis J. 2014 Oct;33(10):1016-22
"Of the 838 eligible children, 281 (34%) met criteria for asthma. Measles antibody waned over time (r = -0.19, P < 0.001), specifically more rapidly in asthmatics (r = -0.30, P < 0.001, a decrease of -0.114 unit per year) than non-asthmatics (r = -0.13, P = 0.002, a decrease of -0.046 unit per year; P value for interaction = 0.010). This differential waning rate resulted in a lower mean (SD) measles antibody concentration [1.42 (0.67) vs. 1.67 (0.69), P = 0.008] and lower seropositivity rate (73% vs. 84%, P = 0.038) in asthmatics than non-asthmatics starting around 9.3 years after the initial measles vaccination.  CONCLUSION: Asthma status is associated with waning kinetics of measles antibody among children."

Race and Ethnic background were found to be significant factors in the antibody response to vaccination in a recent study from The Mayo Clinic.  You can read about it here.

Tuesday, January 26, 2016

Infections Alter Our Genetic Expression

Research published in the Dec 15th issue of the journal Immunity has found that infections alter the expression of host genes.  The changes that result from infection are different for viruses and bacteria and may be used in the future as a way to distinguish viral infections from bacterial ones.  Additionally, they found that the expression of a group of 11 genes were altered by the influenza virus and this could serve as a useful way to distinguish influenza from other viral infections.  They found that the influenza vaccine led to the same changes in gene behavior.  There is hope that this could be a way reduce the overuse of antibiotics by identifying more accurately which infections are viral and therefore not appropriate for antibiotic treatment.  

From this article in Science News about this research and what it means:

"To find the viral fingerprints, computational immunologist Purvesh Khatri of Stanford University and colleagues combed through a wide variety of publicly available datasets that included information about how human genes behaved after an infection of influenza, human rhinovirus and respiratory syncytial virus, or RSV. The researchers churned these diverse datasets through a series of sophisticated mathematical analyses, a process that ultimately pinpointed a consistent viral calling card — a list of nearly 400 genes, each of which grew either more or less active during a viral attack. Many of those genes make proteins known to be involved in virus responses and inflammation."

This is the abstract for the journal article itself:


 While this research looked at the effects on human genes for three viruses, it seems likely that at least some other viruses have this effect as well.  This is particularly interesting since ME/CFS and Fibromyalgia often begin with a viral infection that seems to act as a trigger, maybe this is how?  Maybe some people have some problem with the mechanism that corrects these changes after infection, if that happens, or maybe the way the gene expression is altered is not the same in some people, or maybe there are mutations in these genes that do not become apparent until their expression is changed in this way?  I also can't help but wonder if the flu vaccine alters DNA expression, maybe other vaccines do as well, and again maybe this plays a role in the onset of some adverse reactions and disorders that can follow vaccination?

Thursday, January 14, 2016

Dr Richard Deth on Autism, Methylation, and Dopamine

This interview with Dr Richard Deth Ph.D was available to watch free online for one day and is part of a package deal available from The Autism Intensive, an expert interview series.  These are my notes from the interview.

Dr Deth's lab was the first to identify the D4 dopamine receptor, which has unusual structural features and properties related to methylation.  When dopamine stimulates this receptor it causes methylation of the phospholipids in the membrane.  He got involved in autism research when Dr Martha Herbert, an autism expert from Harvard Medical School, saw this research and told him that this was of interest to the autism community. 

What is methylation?  The word “methyl” refers to a single carbon atom that can be transferred from one molecule to another.  The molecule that receives the carbon atom is said to have been “methylated”.  Methylation is a process that is so common that it affects nearly every aspect of cellular metabolism and function.  It seems that poor methylation is a fundamental issue in autism.  Kids with autism tent to have low levels of methyl donors, and many respond well to supplementation with methyl B12 (mB12).  Of the 6 types of B12 in the body, methyl B12 is the active form for methylation.  Post-mortem studies have found that the levels of B12 are low in the brains of people with autism.  In order to address this, cells need to have access to enough B12 and also have enough glutathione that they can convert B12 to its active form (too much oxidative stress inhibits this process).  This way the cell can decide what is the best form and how much of different forms to make.  There is an assay now that can measure the levels of the 6 forms of B12 in the body, but brain levels can only be measured post-mortem. 

Post-mortem studies have found levels of mB12 in the brains of kids with autism at about 25% of what they should be.  This suggests that there is a problem with the transport systems that bring B12 into the brain, which is a poorly understood process.  B12, along with many other nutrients and products in the blood, is brought into the brain through a structure called the Choroid Plexus.  These structures, one in each of the 4 ventricles of the brain, are part of the blood-brain barrier (BBB) and selectively transport certain nutrients and other things from the blood into the cerebrospinal fluid (CSF).  There are certain proteins that attach to B12 and other things and actively carry them across the BBB.  Dr Deth is currently studying this process to understand better how this process works.  

Dr Deth's research directly shows that heavy metals such as mercury and lead interfere with methylation, which has led to him testifying in front of congress on the issue of vaccine safety, as well as testifying as an expert witness in the federal vaccine court.  He says that since then, the science has further validated this hypothesis and has fleshed out much of the specific details of how this interference occurs.  In particular the growing field of epigenetics has shed a lot of light on this connection.  Epigenetics is the study of how genes are turned on and off to regulate biological function and development, and this regulation of gene activity is controlled by methylation.  Epigenetics is the mechanism that orchestrates development, from the moment of conception throughout our lives, including development of the brain.  So if something interferes with methylation it can profoundly interfere with the process of development.  

Epigenetics is what links the environment and exposures that we get to our genetic expression.  Environmental factors impinge on anti oxidant status, which then impinges on methylation, and methylation *is* development.  Environmental factors include mercury, lead, RoundUp, pesticides, etc.  Genes influence a person's risk of being harmed by these environmental factors, but the genes themselves are not the "cause" of the autism (in most cases).  Among many researchers there is a predetermined certainty that autism must be genetic so they keep looking for the genes over and over despite the lack of results.  Sample sizes of 10,000 genomes have not turned up any consistent findings, and these researchers then say they just need a larger sample size- maybe 50,000 genomes.  Yet you can look at 30 to 50 kids with autism and measure their glutathione levels and find marked differences in these kids.  This finding (of low glutathione) happens all over the world, wherever autistic kids are studied.  What are the factors leading to the low glutathione, which then causes poor methylation and epigenetic problems during development?  

Understanding of autism causality is moving away from a “single agent” hypothesis to a complex interplay between susceptibility to injury and exposure to multiple contributing factors.  Early theories that mercury and thimerosal were involved are still true, and pointed to a mechanism of causality that is very complex and which has been validated and is now better understood.  Now that we know the mechanism, we can see how other factors also come into play.  When gluten and casein are digested, they result in peptides with opiate activity, and research has shown that these peptides interfere with the uptake of cysteine from the GI tract.  Cysteine is necessary for cells to produce glutathione- availability of cysteine is what determines how much glutathione is made.  This results in oxidative stress and damage to the DNA, via poor methylation.  

What is oxidative stress?  Oxidation is the ability to use electrons that we get from food to make energy.  As we metabolize nutrients in our food, our mitochondria use the process of oxidation to make ATP, which is our source of energy.  They do this by converting oxygen to water.  About 3 to 5 percent of the oxygen molecules that go through this process, instead of becoming water, become other oxygen species and are able to oxidize other biological molecules that we don’t want to be oxidized.  ReDox balance is a balance between oxidation molecules and anti-oxidant molecules.  Oxidative stress is the condition of having too many oxidizing molecules and not enough anti-oxidant molecules.  Oxidation damages various proteins and even DNA.  In 2008, Dr Deth published a paper called “The Redox Methylation Hypothesis of Autism”, in which he laid out the connections between the pathways that make anti-oxidants and the pathways that support methylation.  In response to oxidative stress, the body can down regulate methylation to restore balance.  Methylation can help to heal some of the damage to DNA via changing gene expression, but this is not always enough.  Autism is a spectrum because when methylation goes wrong, it affects so many areas of the body, and we each have our own genetic variability so we will each show this damage a bit differently.  Each person must receive treatment tailored to them as an individual. 


The dopamine D4 receptor is critical for attention.  Dopamine and D4 receptors can synchronize different neural networks that might otherwise not be synchronized together, and to tune their frequency of activity.  Frequency is how fast the neurons are firing.  Higher frequencies are more metabolically demanding.  When you are attending to something, dopamine and the D4 receptor make the circuits involved in what you are paying attention to shift to a higher frequency, the gamma frequency, which is 30-80 hz.  The D4 receptors are located in certain cells in the brain called parvalbumin expressing GABAergic interneurons.  Those cells develop post-nataly as the individual's capacity for attention develops.  By 4 to 5 months of age babies begin to be able to pay attention to things.  Problems with methylation could affect attention through this process.  Certain mutations in the gene for the D4 receptor is the biggest risk for developing ADHD.  When asked if this connection between the parvalbumin expressing intern neurons and the ability to pay attention could suggest that people of higher intelligence are more at risk for developing autism,  Dr Deth explains that once you correct the underlying metabolic problems in autism the person's actual intelligence can become revealed.  He goes on to explain his theory that people who are at the highest risk form environmental induced neurodevelopmental injury are people whose genes are poised for intelligence, but intelligence in the brain is a risky undertaking, making the cells are more vulnerable.  It’s a trade-off.  These are more likely to suffer from an environmental injury.  The parvoalbumin cells are the most sensitive cells because their high firing rate means that they have a high metabolic rate, which means that they create more damaging oxidative byproducts (also called reactive oxygen species).  (My thoughts here- this also means that these cells are more dependent on mitochondrial function so may be more sensitive to mito dysfunction).

Dr Deth has written a book called Molecular Origins of Human Attention in which the role of dopamine and D4 receptors is more fully explained.

Additional papers by Dr Deth that discuss methylation and redox imbalance in autism:

How environmental and genetic factors combine to cause autism: A redox/methylation hypothesis.
"Recently higher rates of autism diagnosis suggest involvement of environmental factors in causing this developmental disorder, in concert with genetic risk factors. Autistic children exhibit evidence of oxidative stress and impaired methylation, which may reflect effects of toxic exposure on sulfur metabolism. We review the metabolic relationship between oxidative stress and methylation, with particular emphasis on adaptive responses that limit activity of cobalamin and folate-dependent methionine synthase. Methionine synthase activity is required for dopamine-stimulated phospholipid methylation, a unique membrane-delimited signaling process mediated by the D4 dopamine receptor that promotes neuronal synchronization and attention, and synchrony is impaired in autism. Genetic polymorphisms adversely affecting sulfur metabolism, methylation, detoxification, dopamine signaling and the formation of neuronal networks occur more frequently in autistic subjects. On the basis of these observations, a "redox/methylation hypothesis of autism" is described, in which oxidative stress, initiated by environment factors in genetically vulnerable individuals, leads to impaired methylation and neurological deficits secondary to reductions in the capacity for synchronizing neural networks."
"While autism is still a mysterious developmental disorder, expansion of research efforts over the past 10 to 15 years has yielded a number of important clues implicating both genetic and environmental factors. We can now assert with a measure of confidence that contemporary autism reflects the combined impact of multiple environmental factors on the processes that regulate development in genetically vulnerable individuals. Since epigenetic regulation of gene expression is acknowledged as the most critical factor in development and DNA methylation (the addition of a carbon atom at discrete locations) is the fundamental event for epigenetic regulation, dysfunctional methylation can be considered as a likely cause of autism. Since methylation activity is highly sensitive to oxidative stress (an abnormal redox state) and many environmental factors promote oxidative stress, we have proposed a redox/methylation hypothesis for autism causation. The narrative herein describes the evolution of this hypothesis, which is essentially a series of linked discoveries about how the brain uniquely relies on oxidation and methylation to guide its development and to carry out its cognitive functions."

Saturday, May 2, 2015

Epigenetics and the Stress Response

This is a fascinating TED talk by Karissa Sanbonmatsu called "How you know you're in love -- Epigenetics, stress & gender identity" and has a great description of epigenetics and stress.  The talk itself is really interesting but I will focus here on the parts about epigenetics, which she says "literally means a layer above your genetics.  If your genetics is the hardware, your epigenetics is the software, or the operating system.  Your epigenetics allows the environment to change your DNA."

She discusses research in which the DNA of rats who where raised by attentive vs inattentive mothers was examined, and it was found that the DNA of rat pups who had been nurtured was normal while the DNA of rats who had not been nurtured as pups had markers at the stress response gene that made the rats unable to handle stress throughout their lifetime.  Interestingly, the next generation of pups, the babies of the non-nurtured rats, also had the DNA marker that turned off their stress response gene.  Somehow the treatment that their parents had received as pups had been passed along to them in their DNA.  How can this be happening?

When rat pups are nurtured, serotonin is released in their brains that triggers a "switch" on the DNA, a receptor called Lysine 4, which tells the DNA to unwrap in such a way as to "turn on" a stress response gene, allowing the pups to handle stress.  One way that DNA expression is regulated, as in this case, has to do with the histones that it is wrapped around.  Histones are like spools that the DNA is wrapped around and can be rolled up or unrolled to expose sections of DNA for expression.  The question is, how do these histones "know" what ton do?  How do they "know" the cell's conditions to know how to alter DNA expression, so that genes are expressed at just the right times and then turned back off at the right times?

Many people think that RNA, a large molecule closely related to DNA, might be the answer.  RNA molecules can sense the environment and can go into the nucleus of the cell.  She and her research team found that in the case of gender identity, there does seem to be an RNA molecule that is capable of communicating to histones so that they can in turn alter gene expression based on environmental cues.




Friday, April 3, 2015

Childhood Stress and Trauma Sets the Stage for Health Throughout Our Lifetime

As a pediatrician working in one of San Francisco's poorest and most underserved neighborhoods, Dr Nadine Burke Harris became aware of the significant impact that childhood trauma has on the health of children.  Here she talks about the research showing that not only was she right, the problem is much bigger than that- it turns out that significant trauma in childhood is the single most accurate predictor of a person's health throughout their lifetime.  In this TED talk she discusses that research and why these traumas have the effect that they do:

How Childhood Trauma Affects Health Across a Lifetime

Significant childhood traumas, here referred to as ACEs for Adverse Childhood Experiences, have been shown to:
-increase the risk for 7 out of 10 of the leading causes of death in the US.
-affect brain development, the immune system, the hormonal system, and even the way our DNA is read and transcribed.
-increase the risk of heart disease and lung cancer by a factor of 3.
-shorten life expectancy by 20 years..

She also has a MA degree in public health, and she says that one thing that she learned in that program is that if there is a well, and 98 of 100 kids who drink from it develop diarrhea, as a doctor you can either write prescription after prescription for antibiotics or you can try to figure out what is in the well.  You can use the health outcomes as a clue to fix underlying problems and risks.

The Adverse Childhood Experiences study was done as a collaboration between doctors at Kaiser and the CDC.  It defined ACEs as physical, emotional, or sexual abuse: physical or emotional neglect: parental mental illness, substance dependence, incarceration: parental separation or divorce, or domestic violence.  The ACE score is a measure of how many of these events a person has experienced.  They found a dose-related correlation with health problems throughout life.

Some of the risk correlations that they found for someone with an ACE score of 4 or more include:
2.5 times the risk for COPD and Hepatitis,
4.5 times for depression
12 times for suicide attempts

For someone with an ACE score of 7 or more, the risks are:
3 times the risk for lung cancer,
3.5 times the risk of ischemic heart disease (the number 1 killer in the US),

Some people tried to write this off as a correlation that results from people who had "rough childhoods" making "poor decisions" about their health, and/or engaging in more risky behavior.  This turns out not to be the reason for the correlation.  It is more direct.  For example, this stress affects brain development, such as the the area called the nucleus accumbens that is involved in pleasure and reward and is implicated in substance abuse.  It inhibits the prefrontal cortex which is responsible for executive function and impulse control and important for learning.  Measurable differences can also be seen in the amygdala, the part of the brain that processes emotions and fear.  All of this is to say that there are real biological reasons why people with higher ACE scores might engage in more risky behavior.

However, the risks from ACEs are still there regardless of whether someone engages in risky behavior or not.  The reason for this has to do with the Hypothalamic-Pituitary-Adrenal system, the brain's stress-response system, and the part that controls the fight/flight response.  If you perceive threat, your hypothalamus sends a signal to your pituitary, that then sends a signal to your adrenal glands to respond by releasing stress hormones such as adrenaline and cortisol.  If this system is chronically activated it can go from being an adaptive response to one that is maladaptive and damaging to health, and children are especially sensitive to this.  Because children's bodies are still growing and developing, these ACEs not only affect the brain but also the immune system, the hormonal system, and even our epigenetics- which is the way that our DNA is read and transcribed.

She says it is the job of doctors to use information such as this- information about the causes of disease and poor health outcomes- for treatment and prevention.  In San Francisco she helped found the Center for Youth Wellness, to identify and support kids who need help recovering from ACEs.  They provide home care, mental health services, nutritional services, medication, and other interventions to try to reduce the impact of the ACEs.  Dr Robert Block, former president of the American Academy of Pediatrics, said "Adverse Childhood Experiences are the single greatest unaddressed public health threat facing our nation today".  Why is this information not being addressed?  Is it the perception that this is a problem for "other people"?  The original ACEs study was done in a population that was 70% Caucasian and 70% college educated, so it's not an issue of "those people"- it affects everyone.  Are we in denial?  We need the courage to take this problem seriously.

You can take a quiz on the NPR site to find out your ACE score.  This site has some basic info about what the score means and other factors that also influence health outcomes, such as resiliency.  It also has links to the CDC site about the ACE study and other relevant research.

More on this topic:

How Stress Effects Your Brain (a TED talk/lesson, gives the basics)

The type of PTSD that arises from chronic stress, abuse, or neglect in childhood is bow being called Complex PTSD (or C-PTSD for short).  This is a distinct form of PTSD and not just PTSD that arises from complex factors.  The difference is explained well in this video
C-PTSD vs PTSD - How are they Different?

Childhood, disrupted: Adversity in childhood can create long-lasting scars, damaging our cells and our DNA, and making us sick as adults
"New findings in neuroscience, psychology and immunology tell us that the adversity we face during childhood has farther-reaching consequences than we might ever have imagined. Today, in labs across the country, neuroscientists are peering into the once-inscrutable brain-body connection, and breaking down, on a biochemical level, exactly how the stress we experience during childhood and adolescence catches up with us when we are adults, altering our bodies, our cells, and even our DNA."

"...when children or teens face adversity and especially unpredictable stressors, they are left with deeper, longer‑lasting scars. When the young brain is thrust into stressful situations over and over again without warning, and stress hormones are repeatedly ramped up, small chemical markers, known as methyl groups, adhere to specific genes that regulate the activity of stress‑hormone receptors in the brain. These epigenetic changes hamper the body’s ability to turn off the stress response. In ideal circumstances, a child learns to respond to stress, and recover from it, learning resilience. But kids who’ve faced chronic, unpredictable stress undergo biological changes that cause their inflammatory stress response to stay activated."


This article from Psychology Today gives a more detailed explanation of some of the biological mechanisms responsible for the effects of early stress on the brain.

It's been found that trauma in adulthood is also associated with increased inflammation and disease.

The Science of Stress and How Our Emotions Affect Our Susceptibility to Burnout and Disease
This article is a really good discussion about how stress affects our mental and physical health, and our immune system specifically, and the ways in which they are connected.  It gives some history about how the emotions and physical health were seen as interconnected in many societies in the past, but in the west Descartes' rationalism separated mind from body.  It then discusses the work of Dr Esther Sternberg whose groundbreaking work looking at the interconnection between the central nervous system and immune system has brought the interconnection between the mind and body back into western thought.  It goes on to talk about how memories play a role in how we respond to stress, how acute stress and chronic stress differ biochemically, and how destructive chronic stress is to our bodies.  Lastly, there is mention of how social relationships can help shield us from the effects of stress.  For more on the protective effects of social networks read this page about recent research into the strong degree to which strong social support reduces our health risks.

How Child Abuse Primes the Brain for Future Mental Illness

"Now, in the largest study yet to use brain scans to show the effects of child abuse, researchers have found specific changes in key regions in and around the hippocampus in the brains of young adults who were maltreated or neglected in childhood. These changes may leave victims more vulnerable to depression, addiction and post-traumatic stress disorder (PTSD), the study suggests.

...chronic maltreatment can set the stress system permanently on high alert. That may be useful in some cases — for example, for soldiers who must react quickly during combat or for children trying to avoid their abusers — but over the long term, the dysregulation increases risk for psychological problems like depression and PTSD."


This is the study discussed in this article:
Chronic stress and anxiety can damage the brain, increase the risk of major psychiatric disorders

Stress lies at the heart of disease, addiction
"...we must move beyond the individual model of illness to embrace what he terms a “biopsychosocial” explanation, in which the mind, body and society are seen as an interacting continuum. Cancer, for instance, is usually caused by a number of factors, which may include toxins in our environment, chronic stress, and social isolation. Genes, he added, “can pre-dispose, but not pre-determine” who will get sick.

Mate mentioned a study of breast cancer in women, which found that those who were both over-stressed and lacked strong social connections had a cancer rate nine times higher than women who were stressed but had strong social bonds, as well as those who had weak connections but were not stressed.

Chronic stress — from overwork, poverty, abuse and so on — suppresses the normal function of a person’s immune system, increasing the risk of a host of illnesses."

Biological embedding of stress through inflammation processes in childhood
"Children exposed to adverse psychosocial experiences show elevated disease risk in adulthood. It is therefore important to characterize the biological mechanisms through which children may acquire such lasting vulnerability to disease, namely, the mechanisms of biological embedding."

Early Mortality and Primary Causes of Death in Mothers of Children with Intellectual Disability or Autism Spectrum Disorder: A Retrospective Cohort Study
"During the study period, mothers of children with intellectual disability or ASD had more than twice the risk of death. Mothers of children with intellectual disability were 40% more likely to die of cancer; 150% more likely to die of cardiovascular disease and nearly 200% more likely to die from misadventure than other mothers. Due to small numbers, only hazard ratios for cancer were calculated for mothers of children with ASD. These mothers were about 50% more likely to die from cancer than other mothers. Possible causes and implications of our results are discussed."

This post on the blog Questioning Answers talks about the above study.
"A few other details are also recorded in the Fairthorne study. "Mothers with both a psychiatric disorder and a child with intellectual disability or ASD had about six and a half times the risk of death" was an important finding reported by the authors. When it came to the cause of death, various factors were over-reported in case group mums including cancers, cardiovascular disease and death by misadventure (death due to an unintentional accident, homicide or suicide according to the authors' criteria)."

How Stress Is Making You Lose Your Mind
"The stress hormone cortisol can kill, shrink, and stop the generation of new neurons in a portion of the brain called the hippocampus.  The hippocampus is critical for learning, memory and emotional regulation, as well as shutting off the stress response after a stressful event is over: all much-needed processes in both our professional and personal lives.

Chronic stress can also shrink the medial prefrontal cortex.  This negatively affects decision making, working memory, and control of impulsive behavior. Stress also has the ability to affect stem cells, inhibiting access to the prefrontal cortex, where we plan complex cognitive behavior and moderate social interaction. The result is a brain that is less capable of learning and memory, and more prone to anxiety and depression.

To make matters worse, these same stress hormones can increase the size and activity of a portion of the brain called the amygdala.  The amygdala is critical in the formation and storage of memories associated with highly emotional events. It pairs an event with a feeling, and this connection is stored away in our long-term memory so we can either avoid the event or seek it out in the future. The changes cortisol creates increase negative emotions such as fear, anxiety, and aggression."

This article also talks about the effectiveness of exercise in reversing these effects.

Adverse childhood events appear to increase the risk of being a hypertensive adult
"Children who experience multiple traumatic events, from emotional and sexual abuse to neglect, have higher blood pressures as young adults than their peers, researchers report. The difference of 10 points in the systolic pressure -- the top number denoting pressure while the heart is contracting -- by early adulthood puts these young people at higher risk for hypertension and coronary artery disease by middle and/or old age, said Dr. Shaoyong Su, genetic epidemiologist at the Medical College of Georgia at Georgia Regents University."

Sunday, August 31, 2014

What the Scientific Evidence Tells Us About Autism: it's causes, manifestations, and what to do about it

The biomedical issues that underlie autism (and many other health challenges) are many, and complex, and still in the process of being understood.  New connections and discoveries are being made regularly and they can change the way we look at previous discoveries.  If you follow issues of autism in mainstream media, it seems as though very little is known about autism.  Articles in mainstream media tend to ask more questions than they answer, they recycle old and outdated information and ideas that have been addressed by science (such as the question of whether the increase in autism rates is real or simply the result of better diagnosing), and they portray researchers as simply scratching their heads at this mystery.  There are many reasons for this, but that is another post.  Many people are surprised and shocked when they start to learn that actually, quite a bit is known about autism.  The reality is that the scientific community knows a great deal about autism, there are many thousands of articles in peer-reviewed medical research that paint an elaborate picture of what is going on in this disorder.  The following is a collection of research articles and other high-quality resources an attempt to provide an overview of what this research is showing us.

This video is an overview by Dr Mark Hyman MD, that introduces the idea of autism as a "systemic body disorder that affects the brain", rather than an unchangeable genetic brain disorder, as many doctors today see it, and that "a toxic environment triggered susceptible genes, that many of us have, then this led to the behavioral problems we see".  He also discusses one of the most basic characteristics of science-based care for people with autism- that each person has a unique combination of contributing factors and needs individualized treatment.  

Dr Hyman discusses the work of Dr Martha Herbert, a pediatric neurologist with Harvard Medical School, who has been a pioneer in building a scientific model of autism. She says that "autism is something that develops and is generated by the brain micromoment by micromoment — that is, it is a PROCESS, not a hardwired fixed thing.  It is also something that can potentially be unwound, at least to the point of getting rid of surplus obstructions to function."  

Her website Autism Why and How is an excellent starting point for this journey.  

This is an interview with her, entitled Autism: A Brain Disorder or a Disorder that Affects the brain?, in which she explains some of her ideas.

SOME BASIC ARTICLES

Autism: Maybe It's Not What We've Been Told

Autism: It's Not Just in the Head
"Above all, there is a new emphasis on the interaction between vulnerable genes and environmental triggers, along with a growing sense that low-dose, multiple toxic and infectious exposures may be a major contributing factor to autism and its related disorders. A vivid analogy is that genes load the gun, but environment pulls the trigger."
 
BOOKS

These books are a great (if not overwhelming) tour of some of the science of autism. Each book has a somewhat different focus, and most include information on treatment as well.

WHAT DOES THE SCIENCE SAY?
As for the genetic causes, this study about the autism transcriptome discusses the current understanding
An integrated transcriptomic analysis of autism spectrum disorder
"
Autism spectrum disorder (ASD) is not a single disease but a set of disorders. To find clues of ASD pathogenesis in transcriptomic data, we performed an integrated transcriptomic analysis of ASD...  Functional enrichment analysis demonstrated that differential expressed genes were significantly enriched in inflammation/immune response, mitochondrion-related function and oxidative phosphorylation. Interestingly, genes enriched in inflammation/immune response were up-regulated in the brain tissues and down-regulated in the blood."
 
Integrated genome-wide Alu methylation and transcriptome profiling analyses reveal novel epigenetic regulatory networks associated with autism spectrum disorder
" In ASD blood or blood-derived cells, 320 Alu-inserted genes were reproducibly differentially expressed. Biological function and pathway analysis showed that these genes were significantly associated with neurodevelopmental disorders and neurological functions involved in ASD etiology. Interestingly, estrogen receptor and androgen signaling pathways implicated in the sex bias of ASD, as well as IL-6 signaling and neuroinflammation signaling pathways, were also highlighted. Alu methylation was not significantly different between the ASD and sex- and age-matched control groups. However, significantly altered Alu methylation patterns were observed in ASD cases sub-grouped based on Autism Diagnostic Interview-Revised scores compared with matched controls. Quantitative RT-PCR analysis of Alu expression also showed significant differences between ASD subgroups. Interestingly, Alu expression was correlated with methylation status in one phenotypic ASD subgroup."
 
"It took me a bit by surprise that the heritability of autism was so much lower than previous studies calculated," said Joachim Hallmayer, MD, the first author of the new paper, which appears in the July 4 issue of Archives of General Psychiatry. "Our work suggests that the role of environmental factors has been underestimated."

The study can be read here.

Journal of Immunotoxicology, 2011; 8(1): 68–79
“Autism could result from more than one cause, with different manifestations in different individuals
that share common symptoms. Documented causes of autism include genetic mutations and/or deletions, viral infections, and encephalitis following vaccination. Therefore, autism is the result of genetic defects and/or inflammation of the brain. The inflammation could be caused by a defective placenta, immature blood-brain barrier, the immune response of the mother to infection while pregnant, a premature birth, encephalitis in the child after birth, or a toxic environment.“

Bridging From Cells to Cognition in Autism Pathophysiology: Biological Pathways to Defective Brain Function and Plasticity
American Journal of Biochemistry and Biotechnology Volume 4, Issue 2 Pages 167-176
"We review evidence to support a model where the disease process underlying autism may begin when an in utero or early postnatal environmental, infectious, seizure, or autoimmune insult triggers an immune response that increases reactive oxygen species (ROS) production in the brain that leads to DNA damage (nuclear and mitochondrial) and metabolic enzyme blockade and that these inflammatory and oxidative stressors persist beyond early development (with potential further exacerbations), producing ongoing functional consequences. In organs with a high metabolic demand such as the central nervous system, the continued use of mitochondria with damaged DNA and impaired metabolic enzyme function may generate additional ROS which will cause persistent activation of the innate immune system leading to more ROS production. Such a mechanism would self-sustain and possibly progressively worsen. The mitochondrial dysfunction and altered redox signal transduction pathways found in autism would conspire to activate both astroglia and microglia. These activated cells can then initiate a broad-spectrum proinflammatory gene response. Beyond the direct effects of ROS on neuronal function, receptors on neurons that bind the inflammatory mediators may serve to inhibit neuronal signaling to protect them from excitotoxic damage during various pathologic insults (e.g., infection). In autism, over-zealous neuroinflammatory responses could not only influence neural developmental processes, but may more significantly impair neural signaling involved in cognition in an ongoing fashion. This model makes specific predictions in patients and experimental animal models and suggests a number of targets sites of intervention. Our model of potentially reversible pathophysiological mechanisms in autism motivates our hope that effective therapies may soon appear on the horizon."

Evidence linking oxidative stress, mitochondrial dysfunction, and inflammation in the brain of individuals with autism
Front. Physiol., 22 April 2014
"Autism spectrum disorders (ASDs) are a heterogeneous group of neurodevelopmental disorders that are defined solely on the basis of behavioral observations. Therefore, ASD has traditionally been framed as a behavioral disorder. However, evidence is accumulating that ASD is characterized by certain physiological abnormalities, including oxidative stress, mitochondrial dysfunction and immune dysregulation/inflammation. While these abnormalities have been reported in studies that have examined peripheral biomarkers such as blood and urine, more recent studies have also reported these abnormalities in brain tissue derived from individuals diagnosed with ASD as compared to brain tissue derived from control individuals. A majority of these brain tissue studies have been published since 2010. The brain regions found to contain these physiological abnormalities in individuals with ASD are involved in speech and auditory processing, social behavior, memory, and sensory and motor coordination. This manuscript examines the evidence linking oxidative stress, mitochondrial dysfunction and immune dysregulation/inflammation in the brain of ASD individuals, suggesting that ASD has a clear biological basis with features of known medical disorders. This understanding may lead to new testing and treatment strategies in individuals with ASD."

Gastrointestinal dysfunction in autism spectrum disorder: the role of the mitochondria and the enteric microbiome
Microbial Ecology in Health and Disease, [S.l.], v. 26, may. 2015.
"Autism spectrum disorder (ASD) affects a significant number of individuals worldwide with the prevalence continuing to grow. It is becoming clear that a large subgroup of individuals with ASD demonstrate abnormalities in mitochondrial function as well as gastrointestinal (GI) symptoms. Interestingly, GI disturbances are common in individuals with mitochondrial disorders and have been reported to be highly prevalent in individuals with co-occurring ASD and mitochondrial disease. The majority of individuals with ASD and mitochondrial disorders do not manifest a primary genetic mutation, raising the possibility that their mitochondrial disorder is acquired or, at least, results from a combination of genetic susceptibility interacting with a wide range of environmental triggers. Mitochondria are very sensitive to both endogenous and exogenous environmental stressors such as toxicants, iatrogenic medications, immune activation, and metabolic disturbances. Many of these same environmental stressors have been associated with ASD, suggesting that the mitochondria could be the biological link between environmental stressors and neurometabolic abnormalities associated with ASD. This paper reviews the possible links between GI abnormalities, mitochondria, and ASD. First, we review the link between GI symptoms and abnormalities in mitochondrial function. Second, we review the evidence supporting the notion that environmental stressors linked to ASD can also adversely affect both mitochondria and GI function. Third, we review the evidence that enteric bacteria that are over represented in children with ASD, particularly Clostridia spp., produce short-chain fatty acid metabolites that are potentially toxic to the mitochondria. We provide an example of this gut–brain connection by highlighting the propionic acid rodent model of ASD and the clinical evidence that supports this animal model. Lastly, we discuss the potential therapeutic approaches that could be helpful for GI symptoms in ASD and mitochondrial disorders. To this end, this review aims to help better understand the underlying pathophysiology associated with ASD that may be related to concurrent mitochondrial and GI dysfunction."

What is regressive autism and why does it occur? Is it the consequence of multi-systemic dysfunction affecting the elimination of heavy metals and the ability to regulate neural temperature?
N Am J Med Sci. Jul 2009;1(2):28-47
"There is a compelling argument that the occurrence of regressive autism is attributable to genetic and chromosomal abnormalities, arising from the overuse of vaccines, which subsequently affects the stability and function of the autonomic nervous system and physiological systems. That sense perception is linked to the autonomic nervous system and the function of the physiological systems enables us to examine the significance of autistic symptoms from a systemic perspective. Failure of the excretory system influences elimination of heavy metals and facilitates their accumulation and subsequent manifestation as neurotoxins: the long-term consequences of which would lead to neurodegeneration, cognitive and developmental problems. It may also influence regulation of neural hyperthermia. This article explores the issues and concludes that sensory dysfunction and systemic failure, manifested as autism, is the inevitable consequence arising from subtle DNA alteration and consequently from the overuse of vaccines."

Neuro-immune abnormalities in autism and their relationship with the environment: a variable insult model for autism
Front. Endocrinol., 07 March 2014
"To date, the literature supports a multifactorial model with the largest, most detailed twin study demonstrating strong environmental contribution to the development of the condition. Here, we present a brief review of the neurological, immunological, and autonomic abnormalities in ASD focusing on the causative roles of environmental agents and abnormal gut microbiota. We present a working hypothesis attempting to bring together the influence of environment on the abnormal neurological, immunological, and neuroimmunological functions and we explain in brief how such pathophysiology can lead to, and/or exacerbate ASD symptomatology."

Microglial Activation and Increased Microglial Density Observed in the Dorsolateral Prefrontal Cortex in Autism
Volume 68, Issue 4, 15 August 2010, Pages 368–376
"The activation profile described represents a neuropathological alteration in a sizeable fraction of cases with autism. Given its early presence, microglial activation may play a central role in the pathogenesis of autism in a substantial proportion of patients. Alternatively, activation may represent a response of the innate neuroimmune system to synaptic, neuronal, or neuronal network disturbances, or reflect genetic and/or environmental abnormalities impacting multiple cellular populations."

Neuroinflammation and Autism
N A J Med Sci. 2014;7(3):118-122
"Several epigenetic triggers have been identified, including trauma, adverse reactions to vaccination, infection, and allergies. Neuro-inflammation characterized by microglia/astrocyte activation and brain inflammatory cytokine production have been documented in several post-mortem studies as well as in biomarker studies. Overactivation of microglia and astrocytes has been found in several brain regions during autopsies of autistic brains.  Several studies have shown elevated inflammatory cytokines (such as interleukin ( IL)-1, IL-6, IL8, IL12, tumor necrosis factor (TNF)-α) in serum, plasma, and cerebral spinal fluid (CSF) in children with autism."

"Mast cells are the key players in the inflammatory response and present in all tissues. In the brain, they are mostly found in the diencephalon and generate pro- and anti-inflammatory cytokines upon activation. Mast cell activation can be triggered by both allergic and non-allergic reactions. Mast cells also induce neutrophil infiltration and modulate microglial activation, mediating the neuro-inflammatory process. The fact that ASD children have common immune disorders implicates over activation of mast cells in ASD.  ASD children have more allergic-like reactions. Several inflammatory diseases increase the chance of developing autism, for instance, it was reported that celiac disease increases the risk of ASD by 350%."

Neuro-inflammation, blood-brain barrier, seizures and autism
Journal of Neuroinflammation 2011, 8:168
"Many children with Autism Spectrum Diseases (ASD) present with seizure activity, but the pathogenesis is not understood. Recent evidence indicates that neuro-inflammation could contribute to seizures. We hypothesize that brain mast cell activation due to allergic, environmental and/or stress triggers could lead to focal disruption of the blood-brain barrier and neuro-inflammation, thus contributing to the development of seizures. Treating neuro-inflammation may be useful when anti-seizure medications are ineffective."

Brief Report: ‘‘Allergic Symptoms’’ in Children with Autism Spectrum Disorders. More than Meets the Eye?
J Autism Dev Disord (2011) 41:1579–1585
"subjects with hypersensitive mast cells and/or ASD susceptibility genes may represent a unique subgroup of patients who are more likely to respond to environmental and stress triggers, leading to precipitating or worsening ASD. It is important to investigate mast cell-associated triggers and mediators in patients with ASD, especially close to the time the diagnosis is made.Such efforts could help unveil novel aspects of the pathogenesis of ASD, identify potential biomarkers, as well as establish new therapeutic targets."

This is a slide presentation given by Dr Richard Frye, MD, PhD, director of autism research and associate professor of pediatrics at Arkansas Children's Hospital.
 
Large brains in autism: the challenge of pervasive abnormality.
Neuroscientist. 2005 Oct;11(5):417-40.
"The most replicated finding in autism neuroanatomy- a tendency to unusually large brains- has seemed paradoxical in relation to the specificity of the abnormalities in three behavioral domains that define autism. We now know a range of things about this phenomenon, including that brains in autism have a growth spurt shortly after birth and then slow in growth a few short years afterward, that only younger but not older brains are larger in autism than in controls, that white matter contributes disproportionately to this volume increase and in a nonuniform pattern suggesting postnatal pathology, that functional connectivity among regions of autistic brains is diminished, and that neuroinflammation (including microgliosis and astrogliosis) appears to be present in autistic brain tissue from childhood through adulthood. Alongside these pervasive brain tissue and functional abnormalities, there have arisen theories of pervasive or widespread neural information processing or signal coordination abnormalities (such as weak central coherence, impaired complex processing, and underconnectivity), which are argued to underlie the specific observable behavioral features of autism. This convergence of findings and models suggests that a systems- and chronic disease-based reformulation of function and pathophysiology in autism needs to be considered, and it opens the possibility for new treatment targets."

INFECTIONS
Evidence for Mycoplasma ssp., Chlamydia pneunomiae, and human herpes virus-6 co infections in the blood of patients with autistic spectrum disorders.
J Neurosci Res. 2007 Apr;85(5):1143-8
"We examined the blood of 48 patients from central and southern California diagnosed with autistic spectrum disorders (ASD) by using forensic polymerase chain reaction and found that a large subset (28/48 or 58.3%) of patients showed evidence of Mycoplasma spp. infections compared with two of 45 (4.7%) age-matched control subjects... The results indicate that a large subset of ASD patients shows evidence of bacterial and/or viral infections (odds ratio = 16.5, P < 0.001). The significance of these infections in ASD is discussed in terms of appropriate treatment."

IMMUNE SYSTEM DYSREGULATION
Immunological findings in autism
 2005;71:317-41
"The immunopathogenesis of autism is presented schematically in Fig. 1. Two main immune dysfunctions in autism are immune regulation involving pro-inflammatory cytokines and autoimmunity. Mercury and an infectious agent like the measles virus are currently two main candidate environmental triggers for immune dysfunction in autism. Genetically immune dysfunction in autism involves the MHC region, as this is an immunologic gene cluster whose gene products are Class I, II, and III molecules. Class I and II molecules are associated with antigen presentation. The antigen in virus infection initiated by the virus particle itself while the cytokine production and inflammatory mediators are due to the response to the putative antigen in question. The cell-mediated immunity is impaired as evidenced by low numbers of CD4 cells and a concomitant T-cell polarity with an imbalance of Th1/Th2 subsets toward Th2. Impaired humoral immunity on the other hand is evidenced by decreased IgA causing poor gut protection. Studies showing elevated brain specific antibodies in autism support an autoimmune mechanism. Viruses may initiate the process but the subsequent activation of cytokines is the damaging factor associated with autism. Virus specific antibodies associated with measles virus have been demonstrated in autistic subjects. Environmental exposure to mercury is believed to harm human health possibly through modulation of immune homeostasis. A mercury link with the immune system has been postulated due to the involvement of postnatal exposure to thimerosal, a preservative added in the MMR vaccines. The occupational hazard exposure to mercury causes edema in astrocytes and, at the molecular level, the CD95/Fas apoptotic signaling pathway is disrupted by Hg2+. Inflammatory mediators in autism usually involve activation of astrocytes and microglial cells. Proinflammatory chemokines (MCP-1 and TARC), and an anti-inflammatory and modulatory cytokine, TGF-beta1, are consistently elevated in autistic brains. In measles virus infection, it has been postulated that there is immune suppression by inhibiting T-cell proliferation and maturation and downregulation MHC class II expression. Cytokine alteration of TNF-alpha is increased in autistic populations. Toll-like-receptors are also involved in autistic development. High NO levels are associated with autism. Maternal antibodies may trigger autism as a mechanism of autoimmunity. MMR vaccination may increase risk for autism via an autoimmune mechanism in autism. MMR antibodies are significantly higher in autistic children as compared to normal children, supporting a role of MMR in autism. Autoantibodies (IgG isotype) to neuron-axon filament protein (NAFP) and glial fibrillary acidic protein (GFAP) are significantly increased in autistic patients (Singh et al., 1997). Increase in Th2 may explain the increased autoimmunity, such as the findings of antibodies to MBP and neuronal axonal filaments in the brain. There is further evidence that there are other participants in the autoimmune phenomenon. (Kozlovskaia et al., 2000). The possibility of its involvement in autism cannot be ruled out. Further investigations at immunological, cellular, molecular, and genetic levels will allow researchers to continue to unravel the immunopathogenic mechanisms' associated with autistic processes in the developing brain. This may open up new avenues for prevention and/or cure of this devastating neurodevelopmental disorder."

Immune-Glutamatergic Dysfunction as a Central Mechanism of the Autism Spectrum Disorders
Current Medicinal Chemistry, Volume 16, Number 2, January 2009, pp. 157-170(14)
"Our review brings evidence that most heterogeneous symptoms of ASD have a common set of events closely connected with dysregulation of glutamatergic neurotransmission in the brain with enhancement of excitatory receptor function by pro-inflammatory immune cytokines as the underlying mechanism. We suggest that environmental and dietary excitotoxins, mercury, fluoride, and aluminum can exacerbate the pathological and clinical problems by worsening excitotoxicity and by microglial priming. In addition, each has effects on cell signaling that can affect neurodevelopment and neuronal function. Our hypothesis opens the door to a number of new treatment modes, including the nutritional factors that naturally reduce excitotoxicity and brain inflammation."

Elevated immune response in the brain of autistic patients
Volume 207, Issue 1-2, 15 February 2009, Pages 111-116
"This study determined immune activities in the brain of ASD patients and matched normal subjects by examining cytokines in the brain tissue. Our results showed that proinflammatory cytokines (TNF-α, IL-6 and GM-CSF), Th1 cytokine (IFN-γ) and chemokine (IL-8) were significantly increased in the brains of ASD patients compared with the controls. However the Th2 cytokines (IL-4, IL-5 and IL-10) showed no significant difference. The Th1/Th2 ratio was also significantly increased in ASD patients. Conclusion: ASD patients displayed an increased innate and adaptive immune response through the Th1 pathway, suggesting that localized brain inflammation and autoimmune disorder may be involved in the pathogenesis of ASD."

Proinflammatory and regulatory cytokine production associated with innate and adaptive immune responses in children with autism spectrum disorders and developmental regression
 2001 Nov 1;120(1-2):170-9.
"We determined innate and adaptive immune responses in children with developmental regression and autism spectrum disorders (ASD, N=71), developmentally normal siblings (N=23), and controls (N=17). With lipopolysaccharide (LPS), a stimulant for innate immunity, peripheral blood mononuclear cells (PBMCs) from 59/71 (83.1%) ASD patients produced >2 SD above the control mean (CM) values of TNF-alpha, IL-1beta, and/or IL-6 produced by control PBMCs. ASD PBMCs produced higher levels of proinflammatory/counter-regulatory cytokines without stimuli than controls. With stimulants of phytohemagglutinin (PHA), tetanus, IL-12p70, and IL-18, PBMCs from 47.9% to 60% of ASD patients produced >2 SD above the CM values of TNF-alpha depending on stimulants. Our results indicate excessive innate immune responses in a number of ASD children that may be most evident in TNF-alpha production."

Cytokines and etiopathogenesis of pervasive developmental disorders
Medical Hypotheses. Volume 56, Issue 3, March 2001, Pages 321–324
"However, there is some evidence to suggest that abnormalities of the immune system mediate the pathophysiology of autistic disorder. Cytokines, which play a pivotal role in initiating and maintaining immune responses, have been implicated in the etiopathogenesis of major neuropsychiatric disorders including autism. Cytokines are synthesized in the periphery, as well as in the central nervous system, and exert their effects by binding to their receptors in the nervous tissues. It is suggested that, in genetically predisposed individuals, overproduction or decreased synthesis of certain cytokines may result in neurodevelopmental arrest and/or neurotoxicity.

Elevated serotonin levels in autism: association with the major histocompatibility complex
 1996;34(2):72-5
"Two of the most consistently observed biological findings in autism are increased serotonin levels in the blood and immunological abnormalities (including autoreactivity with tissues of the central nervous system). The purpose of this investigation was to determine if any relationship exists between these two sets of observations. Our laboratory has found and confirmed associations of the major histocompatibility complex (MHC) with autism. Since the MHC is known to regulate the immune system and is also associated with autoimmune disorders, we studied serum serotonin levels in 20 autistic subjects with or without MHC types previously found to be associated with autism. A positive relationship was observed between elevated serotonin levels and the MHC types previously associated with autism."

Serological association of measles virus and human herpesvirus-6 with brain autoantibodies in autism
 1998 Oct;89(1):105-8.
"This study is the first to report an association between virus serology and brain autoantibody in autism; it supports the hypothesis that a virus-induced autoimmune response may play a causal role in autism."

Neuroglial activation and neuroinflammation in the brain of patients with autism
 2005 Jan;57(1):67-81.
"We demonstrate an active neuroinflammatory process in the cerebral cortex, white matter, and notably in cerebellum of autistic patients. Immunocytochemical studies showed marked activation of microglia and astroglia, and cytokine profiling indicated that macrophage chemoattractant protein (MCP)-1 and tumor growth factor-beta1, derived from neuroglia, were the most prevalent cytokines in brain tissues. CSF showed a unique proinflammatory profile of cytokines, including a marked increase in MCP-1. Our findings indicate that innate neuroimmune reactions play a pathogenic role in an undefined proportion of autistic patients, suggesting that future therapies might involve modifying neuroglial responses in the brain."

The "missing link" in autoimmunity and autism: Extracellular mitochondrial components secreted from activated live mast cells
Autoimmunity Reviews 12 (2013) 1136-1142

THE GENETIC PIECE
The Molecular Genetics of Autism Spectrum Disorders: Genomic Mechanisms, Neuroimmunopathology, and Clinical Implications
Autism Research and Treatment Volume 2011 (2011), Article ID 398636, 16 pages
"Autism spectrum disorders (ASDs) have become increasingly common in recent years. The discovery of single-nucleotide polymorphisms and accompanying copy number variations within the genome has increased our understanding of the architecture of the disease. These genetic and genomic alterations coupled with epigenetic phenomena have pointed to a neuroimmunopathological mechanism for ASD. Model animal studies, developmental biology, and affective neuroscience laid a foundation for dissecting the neural pathways impacted by these disease-generating mechanisms. The goal of current autism research is directed toward a systems biological approach to find the most basic genetic and environmental causes to this severe developmental disease. It is hoped that future genomic and neuroimmunological research will be directed toward finding the road toward prevention, treatment, and cure of ASD."

"Autism spectrum disorder (ASD) is a common, highly heritable neurodevelopmental condition characterized by marked genetic heterogeneity. Thus, a fundamental question is whether autism represents an aetiologically heterogeneous disorder in which the myriad genetic or environmental risk factors perturb common underlying molecular pathways in the brain. Here, we demonstrate consistent differences in transcriptome organization between autistic and normal brain by gene co-expression network analysis."
This article in Web MD helps explain this study.  Essentially what it found was differences in autistic brains based on epigenetic regulation.

Paternal sperm DNA methylation associated with early signs of autism risk in an autism-enriched cohort
Int. J. Epidemiol. April 14, 2015
"Epigenetic mechanisms such as altered DNA methylation have been suggested to play a role in autism, beginning with the classical association of Prader-Willi syndrome, an imprinting disorder, with autistic features. (W)e identified 193 differentially methylated regions (DMRs) in paternal sperm with a family-wise empirical P-value [family-wise error rate (FWER)] <0 .05="" 12="" 18="" 450k="" 75="" age="" and="" array="" associated="" at="" autism.="" autism="" autistic="" be="" cerebellum="" cerebellums="" cluster.="" clustered="" compared="" consistent="" contribute="" controls.="" data="" developmental="" differences="" directionally="" dmrs="" epigenetic="" evidence="" family="" for="" further="" gene="" genes="" i="" in="" including="" individuals="" infants="" involved="" many="" may="" mechanisms="" months="" near="" observational="" of="" offspring.="" offspring="" on="" operating="" paternal="" performance="" potentially="" prader-willi="" probes="" processes="" provide="" related="" risk="" scale="" showed="" snord="" sperm="" suggest="" syndrome="" that="" the="" these="" to="" with="" within="">
Mol Psychiatry. 2008 Jan;13(1):90-8. Epub 2007 May 15.
"Biochemical analyses performed on blood platelets and/or cultured cells revealed a highly significant decrease in ASMT activity (P=2 x 10(-12)) and melatonin level (P=3 x 10(-11)) in individuals with ASD. These results indicate that a low melatonin level, caused by a primary deficit in ASMT activity, is a risk factor for ASD. They also support ASMT as a susceptibility gene for ASD and highlight the crucial role of melatonin in human cognition and behavior."

J Autism Dev Disord. 2012 Mar;42(3):367-77
"Oxidative stress and abnormal DNA methylation have been implicated in the pathophysiology of autism. We investigated the dynamics of an integrated metabolic pathway essential for cellular antioxidant and methylation capacity in 68 children with autism, 54 age-matched control children and 40 unaffected siblings. The metabolic profile of unaffected siblings differed significantly from case siblings but not from controls. Oxidative protein/DNA damage and DNA hypomethylation (epigenetic alteration) were found in autistic children but not paired siblings or controls. These data indicate that the deficit in antioxidant and methylation capacity is specific for autism and may promote cellular damage and altered epigenetic gene expression. Further, these results suggest a plausible mechanism by which pro-oxidant environmental stressors may modulate genetic predisposition to autism."

How environmental and genetic factors combine to cause autism: A redox/methylation hypothesis
 2008 Jan;29(1):190-201. Epub 2007 Oct 13
"Recently higher rates of autism diagnosis suggest involvement of environmental factors in causing this developmental disorder, in concert with genetic risk factors. Autistic children exhibit evidence of oxidative stress and impaired methylation, which may reflect effects of toxic exposure on sulfur metabolism. We review the metabolic relationship between oxidative stress and methylation, with particular emphasis on adaptive responses that limit activity of cobalamin and folate-dependent methionine synthase. Methionine synthase activity is required for dopamine-stimulated phospholipid methylation, a unique membrane-delimited signaling process mediated by the D4 dopamine receptor that promotes neuronal synchronization and attention, and synchrony is impaired in autism. Genetic polymorphisms adversely affecting sulfur metabolism, methylation, detoxification, dopamine signaling and the formation of neuronal networks occur more frequently in autistic subjects. On the basis of these observations, a "redox/methylation hypothesis of autism" is described, in which oxidative stress, initiated by environment factors in genetically vulnerable individuals, leads to impaired methylation and neurological deficits secondary to reductions in the capacity for synchronizing neural networks."

Clinical Epigenetics 2012, 4:6 Published: 10 April 2012
"Neurodevelopment can be adversely impacted when gene expression is altered by dietary transcription factors, such as zinc insufficiency or deficiency, or by exposure to toxic substances found in our environment, such as mercury or organophosphate pesticides. Gene expression patterns differ geographically between populations and within populations. Gene variants of paraoxonase-1 are associated with autism in North America, but not in Italy, indicating regional specificity in gene-environment interactions. In the current review, we utilize a novel macroepigenetic approach to compare variations in diet and toxic substance exposure between these two geographical populations to determine the likely factors responsible for the autism epidemic in the United States."
This article discusses the study further.

The contribution of de novo coding mutations to autism spectrum disorder
Nature 515, 216–221
"Whole exome sequencing has proven to be a powerful tool for understanding the genetic architecture of human disease. Here we apply it to more than 2,500 simplex families, each having a child with an autistic spectrum disorder. By comparing affected to unaffected siblings, we show that 13% of de novo missense mutations and 43% of de novo likely gene-disrupting (LGD) mutations contribute to 12% and 9% of diagnoses, respectively. Including copy number variants, coding de novo mutations contribute to about 30% of all simplex and 45% of female diagnoses. Almost all LGD mutations occur opposite wild-type alleles. LGD targets in affected females significantly overlap the targets in males of lower intelligence quotient (IQ), but neither overlaps significantly with targets in males of higher IQ. We estimate that LGD mutation in about 400 genes can contribute to the joint class of affected females and males of lower IQ, with an overlapping and similar number of genes vulnerable to contributory missense mutation. LGD targets in the joint class overlap with published targets for intellectual disability and schizophrenia, and are enriched for chromatin modifiers, FMRP-associated genes and embryonically expressed genes. Most of the significance for the latter comes from affected females."

For more about this study, see this article from NPR.
"These are mutations that crop up spontaneously, not ones that parents pass down to their children. At least 30 percent of autism cases are caused by these spontaneous mutations, according to researchers at Cold Spring Harbor Laboratory."

Medical Hypotheses Volume 56, Issue 4, Pages 462–471, April 2001
"Exposure to mercury can cause immune, sensory, neurological, motor, and behavioral dysfunctions similar to traits defining or associated with autism, and the similarities extend to neuroanatomy, neurotransmitters, and biochemistry. Thimerosal, a preservative added to many vaccines, has become a major source of mercury in children who, within their first two years, may have received a quantity of mercury that exceeds safety guidelines. A review of medical literature and US government data suggests that: (i) many cases of idiopathic autism are induced by early mercury exposure from thimerosal; (ii) this type of autism represents an unrecognized mercurial syndrome; and (iii) genetic and non-genetic factors establish a predisposition whereby thimerosal’s adverse effects occur only in some children."

Empirical Data Confirm Autism Symptoms Related to Aluminum and Acetaminophen Exposure
Entropy 201214(11), 2227-2253
"Our results provide strong evidence supporting a link between autism and the aluminum in vaccines. A literature review showing toxicity of aluminum in human physiology offers further support... Using standard log-likelihood ratio techniques, we identify several signs and symptoms that are significantly more prevalent in vaccine reports after 2000, including cellulitis, seizure, depression, fatigue, pain and death, which are also significantly associated with aluminum-containing vaccines. We propose that children with the autism diagnosis are especially vulnerable to toxic metals such as aluminum and mercury due to insufficient serum sulfate and glutathione. A strong correlation between autism and the MMR (Measles, Mumps, Rubella) vaccine is also observed, which may be partially explained via an increased sensitivity to acetaminophen administered to control fever."

Evidence of Toxicity, Oxidative Stress, and Neuronal Insult in Autism
J Toxicol Environ Health B Crit Rev. 2006 Nov-Dec;9(6):485-99.
"The increase in the rate of autism revealed by epidemiological studies and government reports implicates the importance of external or environmental factors that may be changing. This article discusses the evidence for the case that some children with autism may become autistic from neuronal cell death or brain damage sometime after birth as result of insult; and addresses the hypotheses that toxicity and oxidative stress may be a cause of neuronal insult in autism. The article first describes the Purkinje cell loss found in autism, Purkinje cell physiology and vulnerability, and the evidence for postnatal cell loss. Second, the article describes the increased brain volume in autism and how it may be related to the Purkinje cell loss. Third, the evidence for toxicity and oxidative stress is covered and the possible involvement of glutathione is discussed. Finally, the article discusses what may be happening over the course of development and the multiple factors that may interplay and make these children more vulnerable to toxicity, oxidative stress, and neuronal insult."

Mercury induces inflammatory mediator release from human mast cells
Kempuraj et al. Journal of Neuroinflammation 2010, 7:20
"HgCl2 (mercuric chloride) stimulates VEGF and IL-6 release from human mast cells. This phenomenon could disrupt the blood-brain-barrier and permit brain inflammation. As a result, the findings of the present study provide a biological mechanism for how low levels of mercury may contribute to ASD pathogenesis."

A cleanroom sleeping environment’s impact on markers of oxidative stress, immune dysregulation, and behavior in children with autism spectrum disorders
BMC Complementary and Alternative Medicine 2015, 15:71
"An emerging paradigm suggests children with autism display a unique pattern of environmental, genetic, and epigenetic triggers that make them susceptible to developing dysfunctional heavy metal and chemical detoxification systems. These abnormalities could be caused by alterations in the methylation, sulfation, and metalloprotein pathways. This study sought to evaluate the physiological and behavioral effects of children with autism sleeping in an International Organization for Standardization Class 5 cleanroom. Younger children who slept in the cleanroom altered elemental levels, decreased immune dysregulation, and improved behavioral rating scales, suggesting that their detoxification metabolism was briefly enhanced. The older children displayed a worsening in behavioral rating scale performance, which may have been caused by the mobilization of toxins from their tissues."

Altered heavy metals and transketolase found in autistic spectrum disorder.
Biol Trace Elem Res. 2011 Dec;144(1-3):475-86.
"Our recent clinical survey of patient records from ASD children under the age of 6 years and their age-matched controls revealed evidence of abnormal markers of thiol metabolism, as well as a significant alteration in deposition of several heavy metal species, particularly arsenic, mercury, copper, and iron in hair samples between the groups. Altered thiol metabolism from heavy metal toxicity may be responsible for the biochemical alterations in transketolase, and are mechanisms for oxidative stress production, dysautonomia, and abnormal thiamine homeostasis. It is unknown why the particular metals accumulate, but we suspect that children with ASD may have particular trouble excreting thiol-toxic heavy metal species, many of which exist as divalent cations. Accumulation or altered mercury clearance, as well as concomitant oxidative stress, arising from redox-active metal and arsenic toxicity, offers an intriguing component or possible mechanism for oxidative stress-mediated neurodegeneration in ASD patients. Taken together, these factors may be more important to the etiology of this symptomatically diverse disease spectrum and may offer insights into new treatment approaches and avenues of exploration for this devastating and growing disease."

Environmental mercury release, special education rates, and autism disorder: an ecological study of Texas
Health Place. 2006 Jun;12(2):203-9.
"There was a significant increase in the rates of special education students and autism rates associated with increases in environmentally released mercury. On average, for each 1,000 lb of environmentally released mercury, there was a 43% increase in the rate of special education services and a 61% increase in the rate of autism. The association between environmentally released mercury and special education rates were fully mediated by increased autism rates. This ecological study suggests the need for further research regarding the association between environmentally released mercury and developmental disorders such as autism. These results have implications for policy planning and cost analysis."

Residential Proximity to Freeways and Autism in the CHARGE Study
Environmental Health Perspectives • volume 119 | number 6 | June 2011
"Little is known about environmental causes and contributing factors for autism. Basic science and epidemiologic research suggest that oxidative stress and inflammation may play a role in disease development. Traffic-related air pollution, a common exposure with established effects on these pathways, contains substances found to have adverse prenatal effects... Living near a freeway was associated with autism. Examination of associations with measured air pollutants is needed."
Environ Health Perspect
"Approximately one-third of CHARGE Study mothers lived, during pregnancy, within 1.5 km (just under one mile) of an agricultural pesticide application. Proximity to organophosphates at some point during gestation was associated with a 60% increased risk for ASD, higher for 3rd trimester exposures [OR = 2.0, 95% confidence interval (CI) = (1.1, 3.6)], and 2nd trimester chlorpyrifos applications: OR = 3.3 [95% CI = (1.5, 7.4)]. Children of mothers residing near pyrethroid insecticide applications just prior to conception or during 3rd trimester were at greater risk for both ASD and DD, with OR’s ranging from 1.7 to 2.3. Risk for DD was increased in those near carbamate applications, but no specific vulnerable period was identified."

Environmental and State-Level Regulatory Factors Affect the Incidence of Autism and Intellectual Disability
PLoS Comput Biol 10(3): e1003518
"By analyzing the spatial incidence patterns of autism and intellectual disability drawn from insurance claims for nearly one third of the total US population, we found strong statistical evidence that environmental factors drive the apparent spatial heterogeneity of both phenotypes while economic incentives and population structure appear to have relatively large albeit weaker effects. The strongest predictors for autism were associated with the environment: congenital malformations of the reproductive system in males (an increase in ASD incidence by 283% for every per cent of increase in the incidence of malformations), non-reproductive congenital malformations (31.8% ASD rate increase), and viral infections in males (19% ASD rate increase)."
(The rate of genital malformations was used as a proxy for exposure to toxins).  This article below is a discussion of this study.

"Autism appears to be strongly correlated with rate of congenital malformations of the genitals in males across the country," said study author Andrey Rzhetsky, PhD, professor of genetic medicine and human genetics at the University of Chicago. "This gives an indicator of environmental load and the effect is surprisingly strong."
The Lancet Neurology, Volume 13, Issue 3, Pages 330 - 338, March 2014
"Neurodevelopmental disabilities, including autism, attention-deficit hyperactivity disorder, dyslexia, and other cognitive impairments, affect millions of children worldwide, and some diagnoses seem to be increasing in frequency. Industrial chemicals that injure the developing brain are among the known causes for this rise in prevalence. In 2006, we did a systematic review and identified five industrial chemicals as developmental neurotoxicants: lead, methylmercury, polychlorinated biphenyls, arsenic, and toluene. Since 2006, epidemiological studies have documented six additional developmental neurotoxicants—manganese, fluoride, chlorpyrifos, dichlorodiphenyltrichloroethane, tetrachloroethylene, and the polybrominated diphenyl ethers. We postulate that even more neurotoxicants remain undiscovered. To control the pandemic of developmental neurotoxicity, we propose a global prevention strategy. Untested chemicals should not be presumed to be safe to brain development, and chemicals in existing use and all new chemicals must therefore be tested for developmental neurotoxicity."

Toxic Metals and Essential Elements in Hair and Severity of Symptoms Among Children with Autism
Maedica vol 7 no. , 2012
"Our data supports the historic evidence that heavy metals play a role in the development
of ASD. In combination with an inadequate nutritional status the toxic effect of metals increase along
with the severity of symptoms."
Toxicol Appl Pharmacol. 2006 Jul 15;214(2):99-108. Epub 2006 Jun 16.
"To address a possible environmental contribution to autism, we carried out a retrospective study on urinary porphyrin levels, a biomarker of environmental toxicity, in 269 children with neurodevelopmental and related disorders referred to a Paris clinic (2002-2004), including 106 with autistic disorder. The elevation was significant (P < 0.001). Porphyrin levels were unchanged in Asperger's disorder, distinguishing it from autistic disorder. The atypical molecule precoproporphyrin, a specific indicator of heavy metal toxicity, was also elevated in autistic disorder (P < 0.001) but not significantly in Asperger's. A subgroup with autistic disorder was treated with oral dimercaptosuccinic acid (DMSA) with a view to heavy metal removal. Following DMSA there was a significant (P = 0.002) drop in urinary porphyrin excretion. These data implicate environmental toxicity in childhood autistic disorder."

Level of Trace Elements (copper, zinc, magnesium, and selenium) and toxic elements (lead and mercury) in the hair and nail of children with autism
Biol Trace Elem Res. 2011 Aug;142(2):148-58
"The study observed a valid indication of Cu body burden in the autistic children. The children with different grades of autism showed high significance (p < 0.001) in the level of copper in their hair and nail samples when compared to healthy controls. The level of Cu in the autistic children could be correlated with their degree of severity (more the Cu burden severe is autism). The study showed a significant elevation (p < 0.001) in the levels of toxic metals Pb and Hg in both hair and nail samples of autistic children when compared to healthy control group. The elevation was much pronounced in LFA group subjects when compared among autistic groups MFA and HFA. The levels of trace elements Mg and Se were significantly decreased (p < 0.001) in autistic children when compared to control. The trace element Zn showed significant variation in both hair and nails of LFA group children when compared to control group and other study groups. The significant elevation in the concentration of Cu, Pb, and Hg and significant decrease in the concentration of Mg and Se observed in the hair and nail samples of autistic subjects could be well correlated with their degrees of severity."

Study of some biomarkers in hair of children with autism
Middle East Current Psychiatry: January 2011 - Volume 18 - Issue 1 - p 6–10
"There were highly significant differences between the level of these substances in the hair of children with autism compared with controls, positive correlation of CARS score with both mercury and copper, while intelligence quotient has significant negative correlation with the level of lead in the hair. The level of zinc does not correlate with either CARS score or intelligence quotient.

These preliminary results suggest a complementary role for the studied elements in the pathogenesis of autistic disorder, which should be considered in the management plane."

Arch Gen Psychiatry. 2011;68(11):1104-1112
"In adjusted logistic regression models, we found a 2-fold increased risk of ASD associated with treatment with selective serotonin reuptake inhibitors by the mother during the year before delivery (adjusted odds ratio, 2.2 [95% confidence interval, 1.2-4.3]), with the strongest effect associated with treatment during the first trimester (adjusted odds ratio, 3.8 [95% confidence interval, 1.8-7.8]). No increase in risk was found for mothers with a history of mental health treatment in the absence of prenatal exposure to selective serotonin reuptake inhibitors."

ALTERED BIOCHEMICAL FUNCTIONING
Pathophysiology Volume 13, Issue 3, Pages 171–181, August 2006
"Autism is a severe developmental disorder with poorly understood etiology. Oxidative stress in autism has been studied at the membrane level and also by measuring products of lipid peroxidation, detoxifying agents (such as glutathione), and antioxidants involved in the defense system against reactive oxygen species (ROS). Lipid peroxidation markers are elevated in autism, indicating that oxidative stress is increased in this disease. Levels of major antioxidant serum proteins, namely transferrin (iron-binding protein) and ceruloplasmin (copper-binding protein), are decreased in children with autism. There is a positive correlation between reduced levels of these proteins and loss of previously acquired language skills in children with autism. The alterations in ceruloplasmin and transferrin levels may lead to abnormal iron and copper metabolism in autism. The membrane phospholipids, the prime target of ROS, are also altered in autism. The levels of phosphatidylethanolamine (PE) are decreased, and phosphatidylserine (PS) levels are increased in the erythrocyte membrane of children with autism as compared to their unaffected siblings. Several studies have suggested alterations in the activities of antioxidant enzymes such as superoxide dismutase, glutathione peroxidase, and catalase in autism. Additionally, altered glutathione levels and homocysteine/methionine metabolism, increased inflammation, excitotoxicity, as well as mitochondrial and immune dysfunction have been suggested in autism. Furthermore, environmental and genetic factors may increase vulnerability to oxidative stress in autism. Taken together, these studies suggest increased oxidative stress in autism that may contribute to the development of this disease. A mechanism linking oxidative stress with membrane lipid abnormalities, inflammation, aberrant immune response, impaired energy metabolism and excitotoxicity, leading to clinical symptoms and pathogenesis of autism is proposed."

Metabolic biomarkers of increased oxidative stress and impaired methylation capacity in children with autism
Am J Clin Nutr. 2004 Dec;80(6):1611-7.
"Relative to the control children, the children with autism had significantly lower baseline plasma concentrations of methionine, SAM, homocysteine, cystathionine, cysteine, and total glutathione and significantly higher concentrations of SAH, adenosine, and oxidized glutathione. This metabolic profile is consistent with impaired capacity for methylation (significantly lower ratio of SAM to SAH) and increased oxidative stress (significantly lower redox ratio of reduced glutathione to oxidized glutathione) in children with autism. The intervention trial was effective in normalizing the metabolic imbalance in the autistic children. An increased vulnerability to oxidative stress and a decreased capacity for methylation may contribute to the development and clinical manifestation of autism."

Translational Psychiatry (2012) 2, e134;
"In summary, we show for the first time that peripheral markers of oxidative stress and damage previously observed in plasma and immune cells are similarly elevated in two affected brain regions in autism, cerebellum and BA22. Together, these observations suggest that a pro-oxidant environment and oxidative stress are pervasive and systemic in individuals with autism. The negative association between GSH/GSSG, and oxidative protein and DNA damage suggest that decreased glutathione redox capacity in the autism brain may have functional consequence in terms of increased mitochondrial superoxide production and a chronic inflammatory state."

Oxidative Stress in Autism: Elevated Cerebellar 3-nitrotyrosine Levels
American Journal of Biochemistry and Biotechnology 4 (2): 73-84, 2008
" It has been suggested that oxidative stress and/or mercury compounds play an important role in the pathophysiology of autism. This study compared for the first time the cerebellar levels of the oxidative stress marker 3-nitrotyrosine (3-NT), mercury (Hg) and the antioxidant selenium (Se) levels between control and autistic subjects. Mean cerebellar 3-NT was elevated in autism by 68.9% and the increase was statistically significant (p=0.045). Cerebellar Hg, measured by atomic absorption spectrometry ranged from 0.9 to 35 pmol g 1 tissue in controls (n=10) and from 3.2 to 80.7 pmol g 1 tissue in autistic cases (n=9); the 68.2% increase in cerebellar Hg was not statistically significant. However, there was a positive correlation between cerebellar 3-NT and Hg levels (r=0.7961, p=0.0001). A small decrease in cerebellar Se levels in autism, measured by atomic absorption spectroscopy, was not statistically significant but was accompanied by a 42.9% reduction in the molar ratio of Se to Hg in the autistic cerebellum. While preliminary, the results of the present study add elevated oxidative stress markers in brain to the growing body of data reflecting greater oxidative stress in autism."

Thioredoxin: A novel, independent diagnosis marker in children with autism.
Int J Dev Neurosci. 2014 Nov 26.
"Oxidative stress increases serum thioredoxin (TRX), a redox-regulating protein with antioxidant activity recognized as an oxidative-stress marker. The aim of this study was to assess the clinical significance of serum TRX levels in Autism spectrum disorders (ASD). The results indicated that the median serum TRX levels were significantly higher in children with ASD as compared to typically developing children. Levels of TRX increased with increasing severity of ASD as defined by the CARS score. After adjusting for all other possible covariates, TRX still was an independent diagnosis marker of ASD. Based on the receiver operating characteristic (ROC) curve, the optimal cut-off value of serum TRX levels as an indicator for auxiliary diagnosis of autism was projected to be 10.6ng/ml. Further, we found that an increased diagnosis of ASD was associated with TRX levels ≥10.6ng/ml (adjusted OR 15.31, 95% CI: 7.36-31.85) after adjusting for possible confounders.

CONCLUSIONS:

Our study demonstrated that serum TRX levels were associated with ASD, and elevated levels could be considered as a novel, independent diagnosis indicator of ASD."

Novel metabolic biomarkers related to sulfur-dependent detoxification pathways in autistic patients of Saudi Arabia
BMC Neurol. 2011; 11: 139.
"Xenobiotics are neurotoxins that dramatically alter the health of the child. In addition, an inefficient detoxification system leads to oxidative stress, gut dysbiosis, and immune dysfunction. The consensus among physicians who treat autism with a biomedical approach is that those on the spectrum are burdened with oxidative stress and immune problems. In a trial to understand the role of detoxification in the etiology of autism, selected parameters related to sulfur-dependent detoxification mechanisms in plasma of autistic children from Saudi Arabia will be investigated compared to control subjects... Reduced glutathione, total glutathione, GSH/GSSG and activity levels of GST were significantly lower, GR shows non-significant differences, while, Trx, TrxR and both Prx I and III recorded a remarkably higher values in autistics compared to control subjects... The impaired glutathione status together with the elevated Trx and TrxR and the remarkable over expression of both Prx I and Prx III, could be used as diagnostic biomarkers of autism."

Decreased tryptophan metabolism in patients with Autism Spectrum Disorders
Molecular Autism 2013, 4:16
"Tryptophan is a precursor of important compounds, such as serotonin, quinolinic acid, and kynurenic acid, which are involved in neurodevelopment and synaptogenesis. In addition, quinolinic acid is the structural precursor of NAD+, a critical energy carrier in mitochondria. Also, the serotonin branch of the tryptophan metabolic pathway generates NADH. Lastly, the levels of quinolinic and kynurenic acid are strongly influenced by the activity of the immune system. Therefore, decreased tryptophan metabolism may alter brain development, neuroimmune activity and mitochondrial function. Our finding of decreased tryptophan metabolism appears to provide a unifying biochemical basis for ASDs and perhaps an initial step in the development of a diagnostic assay for ASDs."

"Children with Autism often show difficulties in adapting to change. Previous studies of cortisol, a neurobiologic stress hormone reflecting hypothalamic–pituitary–adrenal (HPA) axis activity, in children with autism have demonstrated variable results. This study measured cortisol levels in children with and without Autism: (1) at rest; (2) in a novel environment; and (3) in response to a blood draw stressor. A significantly higher serum cortisol response was found in the group of children with autism. Analysis showed significantly higher peak cortisol levels and prolonged duration and recovery of cortisol elevation following the blood-stick stressor in children with autism. This study suggests increased reactivity of the HPA axis to stress and novel stimuli in children with autism."

Research in Autism SPectrum DIsorders,Volume 9, January 2015, Pages 174–181
"Researches have shown that individuals with autism often exhibit dysfunction of hypothalamic–pituitary–adrenal (HPA) axis and cytokines. The purpose of this study was to evaluate diurnal variation of cortisol (cortisol VAR), interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) as potential biomarkers for ASD. The present results demonstrated that in comparison to the healthy controls, the individuals with autism showed a lower level of cortisol VAR, higher level of IL-6 and TNF-α. The levels of cortisol VAR, IL-6 and TNF-α have significantly correlations with the severity of ASD measured by CARS scores. The results of ROC analysis indicated the cortisol VAR, IL-6 and TNF-α were potential biomarkers in diagnosis of ASD. The combination of three factors performed the best sensitivity and specificity for diagnosis of ASD. Therefore, the present study may reveal a simple clinical approach with great potential for assisting the diagnosis of ASD."

Metabolic biomarkers related to energy metabolism in Saudi autistic children.
Clin Biochem. 2009 Jul;42(10-11):949-57
"Energy metabolism is usually manipulated in many neurodegenerative diseases. Autism is considered a definable systemic disorder resulting in a number of diverse factors that may affect the brain development and functions both pre and post natal... The obtained data recorded 148.77% and 72.35% higher activities of Na(+)/K(+)ATPase and CK respectively in autistic patients which prove the impairment of energy metabolism in these children compared to age and sex matching healthy controls... Lactate as an important energy metabolite for the brain was significantly higher in autistic patients compared to control showing about 40% increase... The present study confirmed the impairment of energy metabolism in Saudi autistic patients which could be correlated to the oxidative stress previously recorded in the same investigated samples. The identification of biochemical markers related to autism would be advantageous for earlier clinical diagnosis and intervention."

NUTRITIONAL DEFICIENCIES, DIET, AND GUT HEALTH
Nutritional and metabolic status of children with autism vs. neurotypical children, and the association with autism severity
Nutr Metab (Lond). 2011 Jun 8;8(1):34
"The autism group had many statistically significant differences in their nutritional and metabolic status, including biomarkers indicative of vitamin insufficiency, increased oxidative stress, reduced capacity for energy transport, sulfation and detoxification. Several of the biomarker groups were significantly associated with variations in the severity of autism. These nutritional and metabolic differences are generally in agreement with other published results and are likely amenable to nutritional supplementation. Research investigating treatment and its relationship to the co-morbidities and etiology of autism is warranted."

Celiac Disease Presenting as Autism
J Child Neurol January 2010 vol. 25 no. 1 114-119
"After initial investigation suggested underlying celiac disease and varied nutrient deficiencies, a gluten-free diet was instituted along with dietary and supplemental measures to secure nutritional sufficiency. The patient’s gastrointestinal symptoms rapidly resolved, and signs and symptoms suggestive of autism progressively abated. This case is an example of a common malabsorption syndrome associated with central nervous system dysfunction and suggests that in some contexts, nutritional deficiency may be a determinant of developmental delay. It is recommended that all children with neurodevelopmental problems be assessed for nutritional deficiency and malabsorption syndromes."  More about this study here.

Gastrointestinal Symptoms in Autism Spectrum Disorder: A Meta-analysis
PEDIATRICS Vol. 133 No. 5 May 1, 2014 pp. 872 -883
"Results indicate greater prevalence of GI symptoms among children with ASD compared with control children... Future research must address critical questions about the causes and long-term impact of GI symptoms in ASD. Such analyses will require more systematic research and clinical activities, including improved diagnostic screening, standardized assessment, and exploration of potential moderators (eg, dietary restrictions)."

Short-chain fatty acid fermentation products of the gut microbiome: implications in autism spectrum disorders
Microb Ecol Health Dis. 2012; 23: 10.3402/mehd.v23i0.19260.
"Recent evidence suggests potential, but unproven, links between dietary, metabolic, infective, and gastrointestinal factors and the behavioral exacerbations and remissions of autism spectrum disorders (ASDs). Propionic acid (PPA) and its related short-chain fatty acids (SCFAs) are fermentation products of ASD-associated bacteria (Clostridia, Bacteriodetes, Desulfovibrio). SCFAs represent a group of compounds derived from the host microbiome that are plausibly linked to ASDs and can induce widespread effects on gut, brain, and behavior. Intraventricular administration of PPA and SCFAs in rats induces abnormal motor movements, repetitive interests, electrographic changes, cognitive deficits, perseveration, and impaired social interactions. The brain tissue of PPA-treated rats shows a number of ASD-linked neurochemical changes, including innate neuroinflammation, increased oxidative stress, glutathione depletion, and altered phospholipid/acylcarnitine profiles. These directly or indirectly contribute to acquired mitochondrial dysfunction via impairment in carnitine-dependent pathways, consistent with findings in patients with ASDs. Of note, common antibiotics may impair carnitine-dependent processes by altering gut flora favoring PPA-producing bacteria and by directly inhibiting carnitine transport across the gut. Human populations that are partial metabolizers of PPA are more common than previously thought. PPA has further bioactive effects on neurotransmitter systems, intracellular acidification/calcium release, fatty acid metabolism, gap junction gating, immune function, and alteration of gene expression that warrant further exploration. These findings are consistent with the symptoms and proposed underlying mechanisms of ASDs and support the use of PPA infusions in rats as a valid animal model of the condition. Collectively, this offers further support that gut-derived factors, such as dietary or enteric bacterially produced SCFAs, may be plausible environmental agents that can trigger ASDs or ASD-related behaviors and deserve further exploration in basic science, agriculture, and clinical medicine."

Enrichment of Elevated Plasma F2t-Isoprostane Levels in Individuals with Autism Who Are Stratified by Presence of Gastrointestinal Dysfunction
PLOS One Published: July 3, 2013
"Etiology is unknown in the majority of individuals with autism spectrum disorder (ASD). One strategy to investigate pathogenesis is to stratify this heterogeneous disorder based on a prominent phenotypic feature that enriches for homogeneity within population strata. Co-occurring gastrointestinal dysfunction (GID) characterizes a subset of children with ASD. Our current objective was to investigate a potential pathophysiological measure to test the hypothesis that children with both ASD and GID have a more severe metabolic dysfunction than children with ASD-only, given that the highly metabolically active brain and gastrointestinal system may additively contribute measurable impairment. Plasma levels of F2t-Isoprostanes (F2-IsoPs), a gold standard biomarker of oxidative stress, were measured in 87 children in four groups: ASD-GID, ASD-only, GID-only and Unaffected. F2-IsoP levels were elevated in all 3 clinical groups compared to the Unaffected group, with the ASD-GID group significantly elevated above the ASD-only group. Elevation in peripheral oxidative stress is consistent with, and may contribute to, the more severe functional impairments in the ASD-GID group. With unique medical, metabolic, and behavioral features in children with ASD-GID, the present findings serve as a compelling rationale for both individualized approaches to clinical care and integrated studies of biomarker enrichment in ASD subgroups that may better address the complex etiology of ASD."

Food allergy and infantile autism
Panminerva Med. 1995 Sep;37(3):137-41
"Recently some authors have suggested that food peptides might be able to determine toxic effects at the level of the central nervous system by interacting with neurotransmitters. In fact a worsening of neurological symptoms has been reported in autistic patients after the consumption of milk and wheat. The aim of the present study has been to verify the efficacy of a cow's milk free diet (or other foods which gave a positive result after a skin test) in 36 autistic patients. We also looked for immunological signs of food allergy in autistic patients on a free choice diet. We noticed a marked improvement in the behavioral symptoms of patients after a period of 8 weeks on an elimination diet and we found high levels of IgA antigen specific antibodies for casein, lactalbumin and beta-lactoglobulin and IgG and IgM for casein. The levels of these antibodies were significantly higher than those of a control group which consisted of 20 healthy children. Our results lead us to hypothesize a relationship between food allergy and infantile autism as has already been suggested for other disturbances of the central nervous system."

Immune response to dietary proteins, gliadin and cerebellar peptides in children with autism
Nutr  2004 Jun;7(3):151-61.
"We assessed the reactivity of sera from 50 autism patients and 50 healthy controls to specific peptides from gliadin and the cerebellum. A significant percentage of autism patients showed elevations in antibodies against gliadin and cerebellar peptides simultaneously... We conclude that a subgroup of patients with autism produce antibodies against Purkinje cells and gliadin peptides, which may be responsible for some of the neurological symptoms in autism."

Ubiquinol improves symptoms in children with autism.
Oxid Med Cell Longev. 2014;2014:798957. doi: 10.1155/2014/798957. Epub 2014 Feb 23.
"Twenty-four children, aged 3-6 years, with autism according to the DSM IV criteria and using CARS were included in the study. Concentrations of CoQ10-TOTAL, γ- and α-tocopherol, β-carotene, and lipid peroxidation were determined in plasma before and after three months of supportive therapy with ubiquinol at a daily dose 2 × 50 mg. Data on behavior of the children were collected from parents at the same time... Ubiquinol supportive therapy improved symptoms in children with autism, as communication with parents (in 12%), verbal communication (in 21%), playing games of children (in 42%), sleeping (in 34%), and food rejection (in 17%), with CoQ10-TOTAL plasma level above 2.5 μmol/L."

MITOCHONDRIAL DYSFUNCTION
Mitochondrial Dysfunction in Autism
JAMA. Dec 1, 2010; 304(21): 2389–2396.
"Impaired mitochondrial function may influence processes highly dependent on energy, such as neurodevelopment, and contribute to autism... The reduced nicotinamide adenine dinucleotide (NADH) oxidase activity (normalized to citrate synthase activity) in lymphocytic mitochondria from children with autism was significantly lower compared with controls (mean, 4.4 [95% confidence interval {CI}, 2.8-6.0] vs 12 [95% CI, 8-16], respectively; P=.001). The majority of children with autism (6 of 10) had complex I activity below control range values. Higher plasma pyruvate levels were found in children with autism compared with controls (0.23 mM [95% CI, 0.15-0.31 mM] vs 0.08 mM [95% CI, 0.04-0.12 mM], respectively; P=.02). Eight of 10 cases had higher pyruvate levels but only 2 cases had higher lactate levels compared with controls. These results were consistent with the lower pyruvate dehydrogenase activity observed in children with autism compared with controls (1.0 [95% CI, 0.6-1.4] nmol×[min×mg protein]−1 vs 2.3 [95% CI, 1.7-2.9] nmol×[min×mg protein]−1, respectively; P=.01). Children with autism had higher mitochondrial rates of hydrogen peroxide production compared with controls (0.34 [95% CI, 0.26-0.42] nmol×[min×mg of protein]−1 vs 0.16 [95% CI, 0.12-0.20] nmol×[min×mg protein]−1 by complex III; P=.02). Mitochondrial DNA overreplication was found in 5 cases (mean ratio of mtDNA to nuclear DNA: 239 [95% CI, 217-239] vs 179 [95% CI, 165-193] in controls; P=10−4). Deletions at the segment of cytochrome b were observed in 2 cases... In this exploratory study, children with autism were more likely to have mitochondrial dysfunction, mtDNA overreplication, and mtDNA deletions than typically developing children."

Mitochondrial dysfunction in autism spectrum disorders: a population-based study
Developmental Medicine & Child Neurology / Volume / Issue 03 / March 2005, pp 185-189
"Five of 11 patients studied were classified with definite mitochondrial respiratory chain disorder, suggesting that this might be one of the most common disorders associated with autism (5 of 69; 7.2%) and warranting further investigation."

Mitochondrial Dysfunction as a Neurobiological Subtype of Autism Spectrum Disorder: Evidence from Brain Imaging
JAMA Psychiatry. 2014;71(6):665-671
"Impaired mitochondrial function impacts many biological processes that depend heavily on energy and metabolism and can lead to a wide range of neurodevelopmental disorders, including autism spectrum disorder (ASD). Although evidence that mitochondrial dysfunction is a biological subtype of ASD has grown in recent years, no study, to our knowledge, has demonstrated evidence of mitochondrial dysfunction in brain tissue in vivo in a large, well-defined sample of individuals with ASD... In vivo brain findings provide evidence for a possible neurobiological subtype of mitochondrial dysfunction in ASD."

Mitochondrial Energy-Deficient Endophenotype in Autism
American Journal of Biochemistry and Biotechnology 4 (2): 198-207, 2008
"Autism is considered to be influenced by a combination of various genetic, environmental and immunological factors; more recently, evidence has suggested that increased vulnerability to oxidative stress may be involved in the etiology of this multifactorial disorder. Furthermore, recent studies have pointed to a subset of autism associated with the biochemical endophenotype of mitochondrial energy deficiency, identified as a subtle impairment in fat and carbohydrate oxidation. This phenotype is similar, but more subtle than those seen in classic mitochondrial defects. In some cases the beginnings of the genetic underpinnings of these mitochondrial defects are emerging, such as mild mitochondrial dysfunction and secondary carnitine deficiency observed in the subset of autistic patients with an inverted duplication of chromosome 15q11-q13. Such special cases suggest that the pathophysiology of autism may comprise pathways that are directly or indirectly involved in mitochondrial energy production and to further probe this connection three new avenues seem worthy of exploration."

Developmental regression and mitochondrial dysfunction in a child with autism.
J Child Neurol. 2006 Feb;21(2):170-2.
"Autistic spectrum disorders can be associated with mitochondrial dysfunction. We present a singleton case of developmental regression and oxidative phosphorylation disorder in a 19-month-old girl. Subtle abnormalities in the serum creatine kinase level, aspartate aminotransferase, and serum bicarbonate led us to perform a muscle biopsy, which showed type I myofiber atrophy, increased lipid content, and reduced cytochrome c oxidase activity. There were marked reductions in enzymatic activities for complex I and III. Complex IV (cytochrome c oxidase) activity was near the 5% confidence level. To determine the frequency of routine laboratory abnormalities in similar patients, we performed a retrospective study including 159 patients with autism (Diagnostic and Statistical Manual of Mental Disorders-IV and Childhood Autism Rating Scale) not previously diagnosed with metabolic disorders and 94 age-matched controls with other neurologic disorders. Aspartate aminotransferase was elevated in 38% of patients with autism compared with 15% of controls (P <.0001). The serum creatine kinase level also was abnormally elevated in 22 (47%) of 47 patients with autism. These data suggest that further metabolic evaluation is indicated in autistic patients and that defects of oxidative phosphorylation might be prevalent."

Evidence of reactive oxygen species-mediated damage to mitochondrial DNA in children with typical autism
Mol Autism. 2013 Jan 25;4(1):2
"The mitochondrial genome (mtDNA) is particularly susceptible to damage mediated by reactive oxygen species (ROS). Although elevated ROS production and elevated biomarkers of oxidative stress have been found in tissues from children with autism spectrum disorders, evidence for damage to mtDNA is lacking... Sequence variants were evaluated in mtDNA segments from AU and TD children (n = 10; each) and their mothers representing 31.2% coverage of the entire human mitochondrial genome. Increased mtDNA damage in AU children was evidenced by (i) higher frequency of mtDNA deletions (2-fold), (ii) higher number of GC→AT transitions (2.4-fold), being GC preferred sites for oxidative damage, and (iii) higher frequency of G,C,T→A transitions (1.6-fold) suggesting a higher incidence of polymerase gamma incorporating mainly A at bypassed apurinic/apyrimidinic sites, probably originated from oxidative stress. The last two outcomes were identical to their mothers suggesting the inheritance of a template consistent with increased oxidative damage, whereas the frequency of mtDNA deletions in AU children was similar to that of their fathers... These results suggest that a combination of genetic and epigenetic factors, taking place during perinatal periods, results in a mtDNA template in children with autism similar to that expected for older individuals."

"A random retrospective chart review was conducted to document serum carnitine levels on 100 children with autism. Concurrently drawn serum pyruvate, lactate, ammonia, and alanine levels were also available in many of these children. Values of free and total carnitine (p < 0.001), and pyruvate (p=0.006) were significantly reduced while ammonia and alanine levels were considerably elevated (p< 0.001) in our autistic subjects. The relative carnitine deficiency in these patients, accompanied by slight elevations in lactate and significant elevations in alanine and ammonia levels, is suggestive of mild mitochondrial dysfunction. It is hypothesized that a mitochondrial defect may be the origin of the carnitine deficiency in these autistic children."

"Autistic spectrum disorders encompass etiologically heterogeneous persons, with many genetic causes. A subgroup of these individuals has mitochondrial disease. Because a variety of metabolic disorders, including mitochondrial disease show regression with fever, a retrospective chart review was performed and identified 28 patients who met diagnostic criteria for autistic spectrum disorders and mitochondrial disease.... Although the study is small, a subgroup of patients with mitochondrial disease may be at risk of autistic regression with fever. Although recommended vaccinations schedules are appropriate in mitochondrial disease, fever management appears important for decreasing regression risk."

Published online April 21, 2014, (doi: 10.1542/peds.2013-1545)
"Despite the emerging role of mitochondria in immunity, a link between bioenergetics and the immune response in autism has not been explored. Mitochondrial outcomes and phorbol 12-myristate 13-acetate (PMA)–induced oxidative burst were evaluated in granulocytes from age-, race-, and gender-matched children with autism with severity scores of ≥7 (n = 10) and in typically developing (TD) children (n = 10). The oxidative phosphorylation capacity of granulocytes was 3-fold lower in children with autism than in TD children, with multiple deficits encompassing ≥1 Complexes. Higher oxidative stress in cells of children with autism was evidenced by higher rates of mitochondrial reactive oxygen species production (1.6-fold), higher mitochondrial DNA copy number per cell (1.5-fold), and increased deletions. Mitochondrial dysfunction in children with autism was accompanied by a lower (26% of TD children) oxidative burst by PMA-stimulated reduced nicotinamide-adenine dinucleotide phosphate (NADPH) oxidase and by a lower gene expression (45% of TD children's mean values) of the nuclear factor erythroid 2–related factor 2 transcription factor involved in the antioxidant response. Given that the majority of granulocytes of children with autism exhibited defects in oxidative phosphorylation, immune response, and antioxidant defense, our results support the concept that immunity and response to oxidative stress may be regulated by basic mitochondrial functions as part of an integrated metabolic network."

Oxidative stress induces mitochondrial dysfunction in a subset of autistic lymphoblastoid cell lines.
Transl Psychiatry. 2014 Apr 1;4:e377.
"There is an increasing recognition that mitochondrial dysfunction is associated with autism spectrum disorders... Reserve capacity is a measure of the ability of the mitochondria to respond to physiological stress. In this study, we demonstrate, for the first time, that lymphoblastoid cell lines (LCLs) derived from children with autistic disorder (AD) have an abnormal mitochondrial reserve capacity before and after exposure to reactive oxygen species (ROS)... In this AD LCL subgroup, 48-hour pretreatment with N-acetylcysteine, a glutathione precursor, prevented these abnormalities and improved glutathione metabolism, suggesting a role for altered glutathione metabolism associated with this type of mitochondrial dysfunction. The results of this study suggest that a significant subgroup of AD children may have alterations in mitochondrial function, which could render them more vulnerable to a pro-oxidant microenvironment as well as intrinsic and extrinsic sources of ROS such as immune activation and pro-oxidant environmental toxins. These findings are consistent with the notion that AD is caused by a combination of genetic and environmental factors."

Necrosis is increased in lymphoblastoid cell lines from children with autism compared with their non-autistic siblings under conditions of oxidative and nitrosative stress
Mutagenesis. Jul 2013; 28(4): 475–484
"As increased DNA damage events have been observed in a range of other neurological disorders, it was hypothesised that they would be elevated in lymphoblastoid cell lines (LCLs) obtained from children with autism compared with their non-autistic siblings... Following exposure, the cells were microscopically scored for DNA damage, cytostasis and cytotoxicity biomarkers as measured using the cytokinesis-block micronucleus cytome assay. Necrosis was significantly increased in cases relative to controls when exposed to oxidative and nitrosative stress (P = 0.001 and 0.01, respectively). Nuclear division index was significantly lower in LCLs from children with autistic disorder than their non-autistic siblings when exposed to hydrogen peroxide (P = 0.016), but there was no difference in apoptosis, micronucleus frequency, nucleoplasmic bridges or nuclear buds. Exposure to s-nitroprusside significantly increased the number of micronuclei in non-autistic siblings compared with cases (P = 0.003); however, other DNA damage biomarkers, apoptosis and nuclear division did not differ significantly between groups. The findings of this study show (i) that LCLs from children with autism are more sensitive to necrosis under conditions of oxidative and nitrosative stress than their non-autistic siblings and (ii) refutes the hypothesis that children with autistic disorder are abnormally susceptible to DNA damage."

Cellular and mitochondrial glutathione redox imbalance in lymphoblastoid cells derived from children with autism.
FASEB J. 2009 Aug;23(8):2374-83
"Research into the metabolic phenotype of autism has been relatively unexplored despite the fact that metabolic abnormalities have been implicated in the pathophysiology of several other neurobehavioral disorders. Plasma biomarkers of oxidative stress have been reported in autistic children; however, intracellular redox status has not yet been evaluated. Lymphoblastoid cells (LCLs) derived from autistic children and unaffected controls were used to assess relative concentrations of reduced glutathione (GSH) and oxidized disulfide glutathione (GSSG) in cell extracts and isolated mitochondria as a measure of intracellular redox capacity. The results indicated that the GSH/GSSG redox ratio was decreased and percentage oxidized glutathione increased in both cytosol and mitochondria in the autism LCLs. Exposure to oxidative stress via the sulfhydryl reagent thimerosal resulted in a greater decrease in the GSH/GSSG ratio and increase in free radical generation in autism compared to control cells. Acute exposure to physiological levels of nitric oxide decreased mitochondrial membrane potential to a greater extent in the autism LCLs, although GSH/GSSG and ATP concentrations were similarly decreased in both cell lines. These results suggest that the autism LCLs exhibit a reduced glutathione reserve capacity in both cytosol and mitochondria that may compromise antioxidant defense and detoxification capacity under prooxidant conditions."