This blog is a way of sharing the information and resources that have helped me to recover my son Roo from an Autism Spectrum Disorder. What I have learned is to view our symptoms as the results of underlying biological cause, which can be identified and healed. I say "our symptoms" because I also have a neuro-immune disorder called Myalgic Encephalomyelitis.

And, of course, I am not a doctor (although I have been known to impersonate one while doing imaginative play with my son)- this is just our story and information that has been helpful or interesting to us. I hope it is helpful and interesting to you!


Showing posts with label genetics. Show all posts
Showing posts with label genetics. Show all posts

Thursday, March 23, 2023

Advocacy and Support Organizations

American Partnership for Eosinophilic Disorders (APFED) Working diligently to advocate for increased funding, state and federal legislation, and medical coding to benefit those affected by eosinophilic disease 

American Porphyria Foundation

Mast Cell Action was founded in 2016 to offer support to the mast cell disease community, their families, doctors and researchers. To raise awareness of disorders resulting from mast cell activation, increase vital research in this area and strive for better diagnostics and treatment.
 
The Mastocytosis Society is a non-profit organization dedicated to supporting patients affected by Mastocytosis and Mast Cell Activation Disorders as well as their families, caregivers and physicians through research, education and advocacy.

MitoAction’s mission is to improve the quality of life for children, adults, and families living with mitochondrial disease through support, education, outreach, advocacy, clinical research initiatives and by granting wishes for children affected by mitochondrial disease.

MPN (Myeloproliferative Neoplasms) Research Foundation 

The Oley Foundation Striving to enrich the lives of those living with home intravenous nutrition and tube feeding through education, advocacy, and networking.

PACIFHAN (Patient Organizations for Chronic Intestinal Failure and Home Artificial Nutrition)
To work together to promote the international sharing of information and resources to improve the quality of life of Home Artificial Nutrition patients.

National Organization for Albinism and Hypopigmentation (NOAH)

National Organization for Rare Disorders (NORD)

The Ehlers-Danlos Society

 
Change the Air Foundation
Dedicated to increasing awareness and research regarding the negative health impacts of indoor air quality, often as a result of water damage and mold.


 
 



Dysautonomia Foundation, Inc.

Digestive Disease National Coalition

Adrenal Insufficiency United

Gastroparesis Patient Association for Cures and Treatments, Inc. (G-PACT)

Immune Deficiency Foundation

International Foundation for Functional Gastrointestinal Disorders


Kyphoscoliotic Heart Disease

American Porphyria Foundation

American Thoracic Society

American Society of Gene & Cell Therapy (ASGCT)

Daybreak Children's Rare Disease Fund

Family Caregiver Alliance

Healing Hugs Haven LLC

Hermansky-Pudlak Syndrome Network

Hope for Hypothalamic Hamartomas



 The Myelin Project
Myocarditis Foundation

 


Rare and Undiagnosed Network (RUN)

Spinal CSF Leak Foundation


Vasculitis Foundation

Wilhelm Foundation - the Undiagnosed

Worldwide Syringomyelia & Chiari Task Force

Research!America


 

Thursday, April 7, 2016

Many Factors Influence the Individual Response to Vaccination

Variation in vaccine response in normal populations.
Pharmacogenomics. 2004 Jun;5(4):417-27.
"Genetic polymorphisms of the human leukocyte antigen (HLA) system significantly influence the variation in immune responses to viral vaccines. Considerable data on the genetic determinants of immune responses to the measles vaccine support the importance of HLA genes in determining the variation in vaccine response. HLA class I and class II, TAP, and HLA-DM allele associations with measles-specific antibody levels following measles vaccination have revealed, in part, the immunologic basis for mechanisms of measles immunity variation. Associations between HLA genotype and immune responses have also been reported for other vaccines and infectious diseases, such as hepatitis B and C, human papillomaviruses, and influenza. Vaccine pharmacogenomics may provide important insights for the design and development of new peptide-based vaccines against measles and other pathogens."

The link between genetic variation and variability in vaccine responses: systematic review and meta-analyses.
Vaccine. 2014 Mar 26;32(15):1661-9
"Although immune response to vaccines can be influenced by several parameters, human genetic variations are thought to strongly influence the variability in vaccine responsiveness. Systematic reviews and meta-analyses are needed to clarify the genetic contribution to this variability, which may affect the efficacy of existing vaccines. We performed a systematic literature search to identify all studies describing the associations of allelic variants or single nucleotide polymorphisms in immune response genes with vaccine responses until July 2013. The studies fulfilling inclusion criteria were meta-analyzed. Thirteen studies (11,686 subjects) evaluated the associations of human leukocyte antigen (HLA) and other immunity gene variations with the responses to single vaccines, including MMR-II (measles and rubella virus), HepB (hepatitis virus), influenza virus, and MenC (serogroup C meningococcus) vaccines. Seven HLA genetic variants were included in the meta-analyses... (W)hile our findings reinforce the concept that individuals with a particular HLA allelic composition are more likely to respond efficiently to vaccines, future studies should be encouraged to further elucidate the link between genetic variation and variability of the human immune response to vaccines."

"Vaccinations have been used as an essential tool in the fight against infectious diseases, and succeeded in improving public health. However, adverse effects, including autoimmune conditions may occur following vaccinations (autoimmune/inflammatory syndrome induced by adjuvants--ASIA syndrome). It has been postulated that autoimmunity could be triggered or enhanced by the vaccine immunogen contents, as well as by adjuvants, which are used to increase the immune reaction to the immunogen. Fortunately, vaccination-related ASIA is uncommon. Yet, by defining individuals at risk we may further limit the number of individuals developing post-vaccination ASIA. In this perspective we defined four groups of individuals who might be susceptible to develop vaccination-induced ASIA: patients with prior post-vaccination autoimmune phenomena, patients with a medical history of autoimmunity, patients with a history of allergic reactions, and individuals who are prone to develop autoimmunity (having a family history of autoimmune diseases; asymptomatic carriers of autoantibodies; carrying certain genetic profiles, etc.)."


Pediatr Infect Dis J. May 2009; 28(5): 431–432.
"With current and future technologic advances such as high throughput whole-genome scanning, transcriptomics, epigenetics, proteomics, and new biostatistical approaches to understanding huge databases of information, we can better understand associations and mechanisms by which genetically-mediated individual variations in vaccine response and reactivity occur. Armed with such knowledge, the ability to predict such AEs (adverse events), or to design new vaccine approaches that minimize or eliminate serious vaccine-related reactions could be devised, consistent with a more personalized or individual approach to vaccine practice which we have called adversomics (the immunogenetics and immunogenomics of vaccine adverse events at the individual and population level, respectively)...

We believe that adversomics (the immunogenetics and immunogenomics of vaccine adverse events at the individual and population level, respectively) is critical to understanding and preventing serious adverse vaccine-related events, developing the next generation of vaccines, and to improving public confidence in vaccine safety."


Vaccine immunogenetics: bedside to bench to population.
Vaccine. 2008 Nov 18;26(49):6183-8.
"The immunogenetic basis for variations in immune response to vaccines in humans remains largely unknown. Many factors can contribute to the heterogeneity of vaccine-induced immune responses, including polymorphisms of immune response genes. It is important to identify those genes involved directly or indirectly in the generation of the immune response to vaccines. Our previous work with measles reveals the impact of immune response gene polymorphisms on measles vaccine-induced humoral and cellular immune responses. We demonstrate associations between genetic variations (single nucleotide polymorphisms, SNPs) in HLA class I and class II genes, cytokine, cell surface receptor, and toll-like receptor genes and variations in immune responses to measles vaccine. Such information may provide further understanding of genetic restrictions that influence the generation of protective immune responses to vaccines, and eventually the development of new vaccines."

Heterogeneity in vaccine immune response: the role of immunogenetics and the emerging field of vaccinomics.
Clin Pharmacol Ther. 2007 Dec;82(6):653-64.
"Recent advances in the fields of immunology, genetics, molecular biology, bioinformatics, and the Human Genome Project have allowed for the emergence of the field of vaccinomics. Vaccinomics encompasses the fields of immunogenetics and immunogenomics as applied to understanding the mechanisms of heterogeneity in immune responses to vaccines. In this study, we examine the role of HLA genes, cytokine genes, and cell surface receptor genes as examples of how genetic polymorphism leads to individual and population variations in immune responses to vaccines. In turn, this data, in concert with new high-throughput technology, inform the immune-response network theory to vaccine response. Such information can be used in the directed and rational development of new vaccines, and this new golden age of vaccinology has been termed "predictive vaccinology", which will predict the likelihood of a vaccine response or an adverse response to a vaccine, the number of doses needed and even whether a vaccine is likely to be of benefit (i.e., is the individual at risk for the outcome for which the vaccine is being administered?)."

Variability in Humoral Immunity to Measles Vaccine: New Developments.
Trends Mol Med. 2015 Dec;21(12):789-801
"Despite the existence of an effective measles vaccine, resurgence in measles cases in the USA and across Europe has occurred, including in individuals vaccinated with two doses of the vaccine. Host genetic factors result in inter-individual variation in measles vaccine-induced antibodies, and play a role in vaccine failure. Studies have identified HLA (human leukocyte antigen) and non-HLA genetic influences that individually or jointly contribute to the observed variability in the humoral response to vaccination among healthy individuals. In this exciting era, new high-dimensional approaches and techniques including vaccinomics, systems biology, GWAS, epitope prediction and sophisticated bioinformatics/statistical algorithms provide powerful tools to investigate immune response mechanisms to the measles vaccine. These might predict, on an individual basis, outcomes of acquired immunity post measles vaccination."

The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches.
Expert Rev Vaccines. 2013 Jan;12(1):57-70.
"The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of 'vaccinomics' for novel vaccine development."

Hum Immunol. 2010 Apr;71(4):383-91
"Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine."

SNP/haplotype associations in cytokine and cytokine receptor genes and immunity to rubella vaccine.
Immunogenetics. 2010 Apr;62(4):197-210
"An effective immune response to vaccination is, in part, a complex interaction of alleles of multiple genes regulating cytokine networks. We conducted a genotyping study of Th1/Th2/inflammatory cytokines/cytokine receptors in healthy children (n = 738, 11-19 years) to determine associations between individual single-nucleotide polymorphisms (SNPs)/haplotypes and immune outcomes after two doses of rubella vaccine. SNPs (n = 501) were selected using the ldSelect-approach and genotyped using Illumina GoldenGate and TaqMan assays. Rubella-IgG levels were measured by immunoassay and secreted cytokines by ELISA. Linear regression and post hoc haplotype analyses were used to determine associations between single SNPs/haplotypes and immune outcomes. Increased carriage of minor alleles for the promoter SNPs (rs2844482 and rs2857708) of the TNFA gene were associated with dose-related increases in rubella antibodies. IL-6 secretion was co-directionally associated (p < or = 0.01) with five intronic SNPs in the TNFRSF1B gene in an allele dose-related manner, while five promoter/intronic SNPs in the IL12B gene were associated with variations in IL-6 secretion. TNFA haplotype AAACGGGGC (t-statistic = 3.32) and IL12B promoter haplotype TAG (t-statistic = 2.66) were associated with higher levels of (p < or = 0.01) rubella-IgG and IL-6 secretion, respectively. We identified individual SNPs/haplotypes in TNFA/TNFRSF1B and IL12B genes that appear to modulate immunity to rubella vaccination. Identification of such "genetic fingerprints" may predict the outcome of vaccine response and inform new vaccine strategies."

Rubella vaccine-induced cellular immunity: evidence of associations with polymorphisms in the Toll-like, vitamin A and D receptors, and innate immune response genes.
Hum Genet. 2010 Feb;127(2):207-21
"Toll-like, vitamin A and D receptors and other innate proteins participate in various immune functions. We determined whether innate gene-sequence variations are associated with rubella vaccine-induced cytokine immune responses. We genotyped 714 healthy children (11-19 years of age) after two doses of rubella-containing vaccine for 148 candidate SNP markers. Rubella virus-induced cytokines were measured by ELISA. Twenty-two significant associations (range of P values 0.002-0.048) were found between SNPs in the vitamin A receptor family (RARA, RARB, TOP2B and RARG), vitamin D receptor and downstream mediator of vitamin D signaling (RXRA) genes and rubella virus-specific (IFN-gamma, IL-2, IL-10, TNF-alpha, and GM-CSF) cytokine immune responses. A TLR3 gene promoter region SNP (rs5743305, -8441A > T) was associated with rubella-specific GM-CSF secretion. Importantly, SNPs in the TRIM5 gene coding regions, rs3740996 (His43Tyr) and rs10838525 (Gln136Arg), were associated with an allele dose-related secretion of rubella virus-specific TNF-alpha and IL-2/GM-CSF, respectively, and have been previously shown to have functional consequences regarding the antiviral activity and susceptibility to HIV-1 infection. We identified associations between individual SNPs and haplotypes in, or involving, the RIG-I (DDX58) gene and rubella-specific TNF-alpha secretion. This is the first paper to present evidence that polymorphisms in the TLR, vitamin A, vitamin D receptor, and innate immunity genes can influence adaptive cytokine responses to rubella vaccination."

"In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans."

The genetic basis for measles vaccine failure.
Acta Paediatr Suppl. 2004 May;93(445):43-6; discussion 46-7.
"The US measles epidemics of 1989-1991 included a series of outbreaks resulting from vaccine failure. A series of studies was launched aimed at elucidating the mechanisms of this vaccine failure. A meta-analysis of the literature examining epidemics in vaccinated populations was conducted, which showed that the secondary vaccine failure rate (development of the disease despite an initial or primary vaccine success) is no more than 0.2%. The overwhelming proportion of measles vaccine failure was due to primary vaccine failure (failure to ever generate antibody from antigenic stimulation). This comparison of two geographically distinct communities revealed that 10% of children previously vaccinated against measles lacked antibody on follow-up and that these vaccine failures clustered in families. A study of monozygotic and dizygotic twins revealed a high degree of heritability of measles vaccine antibody level. Subsequent studies found associations with both class I and class II alleles in these population-based studies. In the future, detection of the specific peptides that interact with human leukocyte antigen (HLA) molecules may serve as the basis for improved vaccines and address vaccine failure that results from cold-chain problems, immaturity of the immune system, malnutrition and maternal immunity."

"Febrile seizures represent a serious adverse event following measles, mumps and rubella (MMR) vaccination. We conducted a series of genome-wide association scans comparing children with MMR-related febrile seizures, children with febrile seizures unrelated to vaccination and controls with no history of febrile seizures. Two loci were distinctly associated with MMR-related febrile seizures, harboring the interferon-stimulated gene IFI44L (rs273259: P = 5.9 × 10−12 versus controls, P = 1.2 × 10−9 versus MMR-unrelated febrile seizures) and the measles virus receptorCD46 (rs1318653: P = 9.6 × 10−11 versus controls, P = 1.6 × 10−9 versus MMR-unrelated febrile seizures)."

Effects of vitamin A and D receptor gene polymorphisms/haplotypes on immune responses to measles vaccine.
Pharmacogenet Genomics. 2012 Jan;22(1):20-31
"Our results suggest that specific allelic variations and haplotypes in the vitamin A receptor and VDR genes may influence adaptive immune responses to measles vaccine."
Vaccine. 2011 Oct 19;29(45):7883-95
"Identification of host genetic determinants of measles vaccine-induced immunity can be used to design better vaccines and ultimately predict immune responses to vaccination. We performed a comprehensive candidate gene association study across 801 genetic markers in 56 cytokine/cytokine receptor genes, in a racially diverse cohort of 745 schoolchildren after two doses of MMR vaccine. Using linear regression methodologies we examined associations between SNPs/haplotypes and measles virus-specific immunity. Forty-eight significant SNP associations with variations in neutralizing antibodies and measles-specific IFNγ Elispot responses were identified (p<0 .05="" a="" african-americans.="" an="" analysis="" and="" associated="" association="" associations="" but="" caucasian="" caucasians="" cellular="" confirmed="" demonstrated="" determinants="" elispot="" findings="" found="" functional="" genetic="" global="" group="" haplotype="" hr244ile="" humoral="" i="" identify="" il10="" il12b="" il2="" il7r="" immune="" immunity="" important="" in="" including="" level="" manner.="" measles-specific="" measles="" multiple="" new="" non-synonymous="" not="" of="" or="" our="" p-value="0.003)." p="" plausible="" polymorphisms="" previous="" previously="" promoter="" race-specific="" regulating="" replicated="" reported="" responses="" results="" rs1800890="" rs2069762="" rs3212227="" rs6897932="" similarly="" snp="" study="" the="" two="" vaccine-induced="" validate="" variant="" variants="" variations="" were="" with="">

Vaccine. 2004 May 7;22(15-16):1914-20.
"Associations between human leukocyte antigen (HLA) genes and very high levels of antibodies (or hyperseroresponsiveness) to measles antigens in a genetically heterogeneous human population are poorly understood. We studied the association between antibody levels after measles vaccination and HLA class I and II alleles among 170 US schoolchildren who received one dose of measles-mumps-rubella II vaccine. Vaccine recipients were divided into two groups: 93 recipients who were seropositive and 77 recipients who were hyperseropositive (the upper 10th percentile of antibody levels of all subjects). Out of all the alleles analyzed, HLA-B(*)7 (odds ratio (OR) 1.9; P = 0.05), DQA1(*)0104 (OR 4.6; P = 0.02) and DPA1(*)0202 (OR 4.8; P = 0.04) alleles were positively associated with hyperseropositivity, whereas HLA-B(*)44 (OR 0.4; P = 0.02), DRB1(*)01 (OR 0.6; P = 0.09), DRB1(*)08 (OR 0.3; P = 0.04), DQB1(*)0301 (OR 0.5; P = 0.04), and DPB1(*)0401 (OR 0.6; P = 0.03) alleles were negatively associated with hyperseropositivity. The alleles B(*)44, DRB1(*)01, DRB1(*)08 and DQA1(*)0104 remained statistically significant after accounting for the effects of other alleles. The results suggest that HLA alleles have important associations with measles antibody hyperseropositivity. These data increase our understanding of measles vaccine-induced immune response and will be useful for future mechanistic work on measles virus antigen processing and presentation in seronegative and hyperseropositive individuals."

Hum Hered. 2011;72(3):206-23.
"A previously detected association of the CD46 SNP rs2724384 with measles-specific antibodies was successfully replicated in this study. Increased representation of the minor allele G for an intronic CD46 SNP was associated with an allele dose-related decrease (978 vs. 522 mIU/ml, p = 0.0007) in antibody levels. This polymorphism rs2724384 also demonstrated associations with IL-6 (p = 0.02), IFN-α (p = 0.007) and TNF-α (p = 0.0007) responses. Two polymorphisms (coding rs164288 and intronic rs11265452) in the SLAM gene that were associated with measles antibody levels in our previous study were associated with IFN-γ Elispot (p = 0.04) and IL-10 responses (p = 0.0008), respectively, in this study. We found associations between haplotypes, AACGGAATGGAAAG (p = 0.009) and GGCCGAGAGGAGAG (p < 0.001), in the CD46 gene and TNF-α secretion.

Understanding the functional and mechanistic consequences of these genetic polymorphisms on immune response variations could assist in directing new measles and potentially other viral vaccine design, and in better understanding measles immunogenetics."

Hum Genet. 2011 Oct;130(4):547-61.
"Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines."

The association of class I HLA alleles and antibody levels after a single dose of measles vaccine.
Hum Immunol. 2003 Jan;64(1):103-9.
"Despite the success of the current measles vaccine in controlling disease in industrialized countries, the importance of vaccine failure has become increasingly apparent. Our objective was to determine if associations exist between seronegativity after measles vaccination and class I human leukocyte antigen (HLA) alleles. We undertook a cross-sectional observational study in Rochester, Minnesota, with 242 school-age children previously recruited from a communitywide seroprevalence study. We studied two groups of subjects: 72 were seronegative (EIA < or =0.8 after a single dose of measles vaccine) and 170 were seropositive (enzyme immunoassy [EIA] > or =1.0 after one dose). We used the resources of Mayo Clinic's tissue typing laboratory for serotyping class I HLA-A and HLA-B alleles via microlymphocytotoxicity assays. We found no statistically significant associations with class I HLA-A but did find associations with class I HLA-B, which includes alleles associated with seronegativity (B8, B13, and B44) and those associated with seropositivity (B7 and B51). Elucidation of the specific peptide-HLA complex interactions that lead to varying or failed immune responses may provide fertile groundwork for improved vaccines that can overcome limitations of the current live, attenuated measles vaccine."

The association between HLA class I alleles and measles vaccine-induced antibody response: evidence of a significant association.
Vaccine. 1998 Nov;16(19):1869-71.
"While the Moraten strain measles vaccine is an excellent, safe, and immunogenic vaccine, vaccine failure occurs, presumably when an individual develops an inadequate immune response. In this study, we examined the association of HLA class I genes and measles vaccine-induced antibody levels. We found that the allele distribution of HLA-B alleles differed between non-responders and hyper-responders (p = 0.002). Several class I alleles were associated with non-response (HLA-B13, -B44, and -C5); whereas several other alleles were associated with hyper-response (HLA-B7 and -B51). In addition, non-responders were more likely to be HLA-B homozygous than normal responders (odds ratio 2.1), and more likely to be homozygous than hyper-responders (odds ratio 3.7, p = 0.031 Mantel-Haenzel for trend). Finally, we found evidence of an allele dose-response phenomenon for HLA-B7. We conclude that there are important associations between class I HLA genes and measles antibody levels following immunization."

J Investig Med. 1996 Jun;44(5):261-3.
"The distribution of HLA-DRB1 alleles among nonresponders compared to hyper-responders was significantly different (p = 0.014). Nonresponders were significantly less likely to carry the HLA-DRB1*13 alleles than were hyper-responders (7.4% vs 16.2%;p = 0.02). Nonresponders also had an excess of HLA-DRB1*07 alleles (15.4% vs 6.2%; p = 0.015).

The absence of HLA-DRB1*13 alleles is associated with measles vaccine nonresponse. The absence of this allele has also been associated with susceptibility to other infectious diseases. The role of this gene in the immunogenetic response to infectious diseases requires further study."

Relationship of HLA-DQA1 alleles and humeral antibody following measles vaccination.
Int J Infect Dis. 1998 Jan-Mar;2(3):143-6.
"HLA-DQA1 alleles have important associations with the antibody response to measles vaccine. Specifically, the carriage of the HLA-DQA1*05 alleles is associated with nonresponse and that of HLA-DQA1*01 alleles with hyper response. In addition, HLA-DQA1 homozygosity is significantly associated with poor antibody response to measles vaccine."

Differential HLA gene expression in measles vaccine seropositive and seronegative subjects: a pilot study.
Scand J Infect Dis. 2003;35(5):332-6.
"This is the first study using GeneChip technology to elucidate genetic determinants of the measles vaccine response. A comparative gene expression study was conducted using Affymetrix's Human GeneChip U-95A in 5 human subjects immunized with a 'booster' dose of measles vaccine (Attenuax, Merck) to determine whether serologically distinct subjects exhibit differential expression of human leukocyte antigen (HLA) genes. Healthy individuals aged 15-25 y, previously immunized with 2 doses of measles-mumps-rubella-II (MMR-II) vaccine, were classified as measles vaccine immunoglobulin G-specific antibody seronegatives (n = 2) and seropositives (n = 3). Changes in expression of HLA genes in seronegatives and seropositives were studied on days 7 and 14 post-measles vaccination using Microarray Suite 5.0 (MAS 5.0). There was increased expression of the HLA class I-B (p = 0.0002), HLA class II cluster of DMA, DMB, TAP1, TAP2 (p = 0.0007) and HLA-DR (p = 0.0001) genes, and decreased expression of HLA class I MICB molecule (p = 1), HLA class I-A (p = 0.9999) and major histocompatibility complex class III HSP 70 (p = 0.9999) genes on day 7 or day 14 postvaccination in seropositives compared with seronegatives. These results suggest an association between antibody response and differential HLA gene activation and may explain one potential mechanism underlying measles vaccine non-response."

Polymorphisms of the TAP2 gene may influence antibody response to live measles vaccine virus.
Vaccine. 1997 Jan;15(1):3-6.
"These data reveal an association between TAP2 genotype and measles vaccine antibody response which may explain one mechanism behind vaccine failure."

Asthma status and waning of measles antibody concentrations after measles immunization.
Pediatr Infect Dis J. 2014 Oct;33(10):1016-22
"Of the 838 eligible children, 281 (34%) met criteria for asthma. Measles antibody waned over time (r = -0.19, P < 0.001), specifically more rapidly in asthmatics (r = -0.30, P < 0.001, a decrease of -0.114 unit per year) than non-asthmatics (r = -0.13, P = 0.002, a decrease of -0.046 unit per year; P value for interaction = 0.010). This differential waning rate resulted in a lower mean (SD) measles antibody concentration [1.42 (0.67) vs. 1.67 (0.69), P = 0.008] and lower seropositivity rate (73% vs. 84%, P = 0.038) in asthmatics than non-asthmatics starting around 9.3 years after the initial measles vaccination.  CONCLUSION: Asthma status is associated with waning kinetics of measles antibody among children."

Race and Ethnic background were found to be significant factors in the antibody response to vaccination in a recent study from The Mayo Clinic.  You can read about it here.

Monday, August 25, 2014

SNP Resources by Gene and by Disorder

This post is a collection of articles and resources with more information about specific SNPs (Single Nucleotide Polymorphisms) and about which SNPs are involved in specific disorders and diseases.  I will update it as I find more.

BY SNP:

CBS
And arsenic toxicity

COMT
Dopamine and Methylation (Yasko video)
And Fibromyalgia
And Vitiligo
and prefrontal cortex function
and brain function and schizophrenia

DAO and DAOA
And Autism

IGF1
and IL6 and longevity in males
and Lupus
and Colorectal Adenomas and Hyperplastic Polyps
and Papillary Thyroid Carcinoma

IL6R and Mastocytosis

KIT and Mastocytosis

MAO is inhibited by quercetin

MTHFR

NOS2 and Parkinson's

SULT2A1 and PCOS

TYR and albinism



BY DISORDER/DISEASE:



Albinism (OCA) and tyrosinase SNPs

Allergy/Atopy 

Arsenic Toxicity
and CBS

Autism
The Molecular Genetics of Autism Spectrum Disorders: Genomic Mechanisms, Neuroimmunopathology, and Clinical Implications

Autism and DAO and DAOA

SNPs associated with auto-immune conditions



Colorectal Adenomas and IGF1


Fibromyalgia and COMT

Hypermethioninemia

Lupus and IGF1



Mastocytosis
and IL6 SNPs
and KIT SNPs

Parkinson's and NOS2

PCOS and SULT2A1

POTS

Schizophrenia and COMT

Vitiligo and COMT




Saturday, February 2, 2013

Epigenetics, or Why the Question isn't "Environment OR Genetics"

The study of genetics has been all the rage recently in medical science.  While it has led to some groundbreaking developments in the treatment of disease as well as even how we conceive of the concept of disease, it has been emphasized as the PRIMARY factor in so many cases in a way reminiscent of the saying "when holding a hammer, everything looks like a nail".  Most people seem to understand the idea of a genetic cause for illness, or even a genetic role in disease, as meaning that we are helpless to do anything to treat or prevent the illness; that all we can do is throw up our hands and admit powerlessness.  More than anything, autism is the example of this kind of thinking as well as the example that shows the fallacy of this viewpoint. 

This is largely due to the fact that most people have an outdated and very incomplete idea of what the term "genetic" means.  In high school biology class I was taught that our DNA hold the instructions for making us, encoded in a series of nucleotides (As, Ts, Gs, and Cs).  Our "genetic code" is seen as a kind if instruction book that says "make this person this tall, with this color hair and eyes, and with this personality".  It is seen by many as something that is "used" in the beginning, when we are growing as a fetus, and that results in unchangeable characteristics in us.  This is actually quite far from the truth.  An excellent article about epigenetics and how they relate to our behavior and health was recently published in the magazine Discover, which is a great place to start in understanding this perspective.  You can also watch a narrated slide show from the science show NOVA about epigenetics here...another level or aspect of our genetics that is keenly responsive to our environment: 

This is a quote from the webpage with the link to the slideshow "In this audio slide show, Dr. Dana Dolinoy of Duke University explains the role that the epigenome, a sort of second genome, plays in regulating the expression of our genes. As Dolinoy notes, we can no longer say with certainty whether genetics or the environment have a greater impact on our health, because the two are inextricably linked through the epigenome."  Let me emphasize that last part..."we can no longer say with certainty whether genetics or the environment have a greater impact on our health, because the two are inextricably linked through the epigenome."   The question that dominates media coverage of autism- the question of "whether the cause is genetic OR environmental" is moot.  It is both, both are inter-related.  There is another famous quote (please post in the comments if you remember who said it, I don't) is "genetics is stored environment". 

The "reading" of your genetic code is not a passive process but an active process that is influenced by your environment, it is regulated by proteins that control which genes are turned on and when, in which part of the development process, and for how long. Many toxins in the environment including metals, pesticides, and chemical additives are known to effect this process, as are infections, nutritional factors, and even social factors. This quote from the journal article Prenatal environmental exposures, epigenetics, and disease explains this very well:

"Epigenetics is the study of heritable changes in gene expression or phenotype occurring without changes in DNA sequence. The genetic information in DNA has been likened to the notes of an orchestral score and epigenetics to the conductor who interprets the score and controls the dynamics of the symphonic performance. While new epigenetic mechanisms are being uncovered, the best characterized are DNA methylation, changes in histone proteins around which DNA is packaged, and expression of non-coding RNAs. Interactions between these epigenetic mechanisms generate diversity of cell types during development and then maintain the expression profiles of the different cell types throughout life. The term “environmental epigenomics” reflects the constant interplay between the environment, which includes both endogenous (such as hormone levels or immune status) and exogenous factors (such as nutritional and chemical exposures), and the epigenome. The best characterized epigenetic events in early mammalian development are genomic imprinting (the silencing of one parental allele at a single locus, which occurs in the parental germ stem cells) resulting in monoallelic gene expression and x-chromosome inactivation (silencing of one of the two X chromosomes in mammalian females) occurring in early embryogenesis. Dysregulation of imprinted genes during early development is involved in disorders such as Angelman’s, Prader-Willi and Beckwith-Wiederman Syndromes, certain cancers, and possibly in autism and other neurological syndromes."

For more on the basics of epigenetics: 

Epigenetics and the influence of our genes this is a TED talk that is both thorough and dense but very helpful.

There is an episode of the tv show NOVA called "Ghost in Your Genes" that provides a good introduction to how epigenetics works.

The Power Of Genes, And The Line Between Biology And Destiny from NPR

The illustrated guide to epigenetics (from the magazine Mother Jones)

For very detailed and advanced information about epigenetics this lecture by Dr. Laura Landweber is very good "Epigenetics: Rewriting the information in DNA".

Also Science 101 for Parents: How Epigenetics is Revolutionizing the Understanding of Heredity which is a lecture presented at Rockefeller University that also gets into more advanced topics and also is more focused on the role of epigenetics in child development.